ATCG00220
ERF Family

One of the components of the core complex of photosystem II (PSII). PSII is a light-driven water plastoquinone oxidoreductase that uses light energy to abstract electrons from H(2)O, generating O(2) and a proton gradient subsequently used for ATP formation. It consists of a core antenna complex that captures photons, and an electron transfer chain that converts photonic excitation into a charge separation. This subunit is found at the monomer-monomer interface

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
Pt
OG0026995
Physical Location & Seq
Reverse (-)
28707 .. 28811
105 bp
Loading structure...
UTR
Exon/CDS
Intron
ATCG00220.1

Sequence Viewer

Length: 105 bp
ATGGAAGTAAATATTCTTGCATTTATTGCTACTGCACTCTTCATTCTCGTTCCTACTGCTTTTTTGCTTATAATTTACGTAAAAACCGTTAGTCAAAATGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00195 ko01100 map00195 map01100
Pfam Domains
Protein Families
PsbM

Protein Analysis

34

Amino Acids

3.78

Weight (kDa)

4.67

Isoelectric Point (pI)

44.44

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PsbM PF05151 1 - 31 5.9e-19 Photosystem II reaction centre M protein (PsbM)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0026995)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00220
pyrus_communis pycom12397g00310

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 71
BsaAI YACGTR 1 cut(s) 79
BsgI GTGCAG 1 cut(s) 18
Bst4CI ACNGT 1 cut(s) 88
Bst6I CTCTTC 1 cut(s) 44
BstAPI GCANNNNNTGC 1 cut(s) 26
BstBAI YACGTR 1 cut(s) 79
BstMWI GCNNNNNNNGC 1 cut(s) 26
BstSNI TACGTA 1 cut(s) 79
Eam1104I CTCTTC 1 cut(s) 44
EarI CTCTTC 1 cut(s) 44
Eco105I TACGTA 1 cut(s) 79
FaiI YATR 1 cut(s) 71
FspEI CC 2 cut(s) 66, 100
HpyCH4III ACNGT 1 cut(s) 88
HpyCH4IV ACGT 1 cut(s) 78
HpyCH4V TGCA 2 cut(s) 20, 35
HpyF10VI GCNNNNNNNGC 1 cut(s) 26
HpySE526I ACGT 1 cut(s) 78
MaeII ACGT 1 cut(s) 78
MboII GAAGA 1 cut(s) 31
MluCI AATT 1 cut(s) 72
MseI TTAA 1 cut(s) 103
MspJI CNNR 8 cut(s) 29, 50, 59, 63, 65, 76, 80, 91
MwoI GCNNNNNNNGC 1 cut(s) 26
PcsI WCGNNNNNNNCGW 1 cut(s) 84
Ppu21I YACGTR 1 cut(s) 79
PsiI TTATAA 1 cut(s) 71
SaqAI TTAA 1 cut(s) 103
SetI ASST 1 cut(s) 81
SgeI CNNG 2 cut(s) 29, 59
SnaBI TACGTA 1 cut(s) 79
Sse9I AATT 1 cut(s) 72
SspI AATATT 1 cut(s) 13
TaaI ACNGT 1 cut(s) 88
TaiI ACGT 1 cut(s) 81
TasI AATT 1 cut(s) 72
Tru1I TTAA 1 cut(s) 103
Tru9I TTAA 1 cut(s) 103
TspDTI ATGAA 1 cut(s) 31
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.