pycom12397g00310
ERF Family

One of the components of the core complex of photosystem II (PSII). PSII is a light-driven water plastoquinone oxidoreductase that uses light energy to abstract electrons from H(2)O, generating O(2) and a proton gradient subsequently used for ATP formation. It consists of a core antenna complex that captures photons, and an electron transfer chain that converts photonic excitation into a charge separation. This subunit is found at the monomer-monomer interface

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012397
Physical Location & Seq
Forward (+)
153471 .. 153740
270 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12397g00310.1

Sequence Viewer

Length: 270 bp
ATGAATCGATTTGATAGCTCCGATATTGTTATTCATGATATTGATCCGATTCGATATCATCGAGATTTAATGCATCCCATTGAATTTCCAGGCGAAAGATTTATTATCTCTATGGGATTAACTCCCGAGTTATTGCGAATTAAAGAAAAATTAAACAATGAGATTATGGAAGTAAATATTCTCGCATTTATTGCTACTGCACTGTTTATTCTAGTTCCTACTGCTTTTTTACTTATAATATACGTAAAAACAGTCAGCCAAGGTGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

10.28

Weight (kDa)

5.21

Isoelectric Point (pI)

46.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PsbM PF05151 56 - 86 8.3e-18 Photosystem II reaction centre M protein (PsbM)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0026995)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00220
pyrus_communis pycom12397g00310

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 236
AclWI GGATC 1 cut(s) 38
AcsI RAATTY 1 cut(s) 83
AgsI TTSAA 1 cut(s) 83
AjnI CCWGG 1 cut(s) 88
AluBI AGCT 1 cut(s) 18
AluI AGCT 1 cut(s) 18
AlwI GGATC 1 cut(s) 38
Ama87I CYCGRG 1 cut(s) 125
ApoI RAATTY 1 cut(s) 83
AvaI CYCGRG 1 cut(s) 125
BciT130I CCWGG 1 cut(s) 90
BfaI CTAG 1 cut(s) 212
Bme1390I CCNGG 1 cut(s) 90
BmeT110I CYCGRG 1 cut(s) 125
BmrFI CCNGG 1 cut(s) 90
BmsI GCATC 1 cut(s) 82
Bsa29I ATCGAT 1 cut(s) 7
BsaAI YACGTR 1 cut(s) 244
BsaBI GATNNNNATC 1 cut(s) 42
BsaJI CCNNGG 1 cut(s) 259
Bse8I GATNNNNATC 1 cut(s) 42
BseBI CCWGG 1 cut(s) 90
BseCI ATCGAT 1 cut(s) 7
BseDI CCNNGG 1 cut(s) 259
BseGI GGATG 1 cut(s) 73
BseJI GATNNNNATC 1 cut(s) 42
BsgI GTGCAG 1 cut(s) 183
BshVI ATCGAT 1 cut(s) 7
BsiHKCI CYCGRG 1 cut(s) 125
BsoBI CYCGRG 1 cut(s) 125
Bsp143I GATC 1 cut(s) 43
BspDI ATCGAT 1 cut(s) 7
BspHI TCATGA 1 cut(s) 34
BspPI GGATC 1 cut(s) 38
BssECI CCNNGG 1 cut(s) 259
BssMI GATC 1 cut(s) 43
BssT1I CCWWGG 1 cut(s) 259
Bst2UI CCWGG 1 cut(s) 90
Bst4CI ACNGT 2 cut(s) 204, 253
BstAPI GCANNNNNTGC 1 cut(s) 191
BstBAI YACGTR 1 cut(s) 244
BstF5I GGATG 1 cut(s) 73
BstKTI GATC 1 cut(s) 46
BstMBI GATC 1 cut(s) 43
BstMWI GCNNNNNNNGC 1 cut(s) 191
BstNI CCWGG 1 cut(s) 90
BstSCI CCNGG 1 cut(s) 88
BstSNI TACGTA 1 cut(s) 244
Bsu15I ATCGAT 1 cut(s) 7
BsuTUI ATCGAT 1 cut(s) 7
BtsCI GGATG 1 cut(s) 73
BtsIMutI CAGTG 1 cut(s) 200
CciI TCATGA 1 cut(s) 34
ClaI ATCGAT 1 cut(s) 7
CviAII CATG 1 cut(s) 35
CviJI RGCY 2 cut(s) 18, 258
CviKI_1 RGCY 2 cut(s) 18, 258
DpnI GATC 1 cut(s) 45
DpnII GATC 1 cut(s) 43
Eco105I TACGTA 1 cut(s) 244
Eco130I CCWWGG 1 cut(s) 259
Eco32I GATATC 1 cut(s) 56
Eco88I CYCGRG 1 cut(s) 125
EcoRII CCWGG 1 cut(s) 88
EcoRV GATATC 1 cut(s) 56
EcoT14I CCWWGG 1 cut(s) 259
EcoT22I ATGCAT 1 cut(s) 75
ErhI CCWWGG 1 cut(s) 259
FaeI CATG 1 cut(s) 38
FaiI YATR 5 cut(s) 36, 113, 167, 236, 241
FatI CATG 1 cut(s) 34
FokI GGATG 1 cut(s) 60
FspBI CTAG 1 cut(s) 212
Hin1II CATG 1 cut(s) 38
HinfI GANTC 2 cut(s) 4, 49
Hpy188I TCNGA 2 cut(s) 22, 48
Hpy188III TCNNGA 3 cut(s) 35, 62, 125
HpyCH4III ACNGT 2 cut(s) 204, 253
HpyCH4IV ACGT 1 cut(s) 243
HpyCH4V TGCA 2 cut(s) 73, 200
HpyF10VI GCNNNNNNNGC 1 cut(s) 191
HpySE526I ACGT 1 cut(s) 243
Hsp92II CATG 1 cut(s) 38
Kzo9I GATC 1 cut(s) 43
LmnI GCTCC 1 cut(s) 23
LpnPI CCDG 2 cut(s) 75, 102
LweI GCATC 1 cut(s) 82
MaeI CTAG 1 cut(s) 212
MaeII ACGT 1 cut(s) 243
MalI GATC 1 cut(s) 45
MboI GATC 1 cut(s) 43
MluCI AATT 3 cut(s) 83, 138, 149
Mph1103I ATGCAT 1 cut(s) 75
MseI TTAA 5 cut(s) 68, 119, 141, 152, 268
MspR9I CCNGG 1 cut(s) 90
MvaI CCWGG 1 cut(s) 90
MwoI GCNNNNNNNGC 1 cut(s) 191
NdeII GATC 1 cut(s) 43
NlaIII CATG 1 cut(s) 38
NsiI ATGCAT 1 cut(s) 75
PagI TCATGA 1 cut(s) 34
PcsI WCGNNNNNNNCGW 1 cut(s) 58
PfeI GAWTC 2 cut(s) 4, 49
Ppu21I YACGTR 1 cut(s) 244
PsiI TTATAA 1 cut(s) 236
Psp6I CCWGG 1 cut(s) 88
PspGI CCWGG 1 cut(s) 88
SaqAI TTAA 5 cut(s) 68, 119, 141, 152, 268
Sau3AI GATC 1 cut(s) 43
ScrFI CCNGG 1 cut(s) 90
SetI ASST 3 cut(s) 20, 246, 265
SfaNI GCATC 1 cut(s) 82
SgeI CNNG 8 cut(s) 47, 74, 101, 102, 137, 139, 194, 224
SnaBI TACGTA 1 cut(s) 244
Sse9I AATT 3 cut(s) 83, 138, 149
SspI AATATT 1 cut(s) 178
SspMI CTAG 1 cut(s) 212
StyD4I CCNGG 1 cut(s) 88
StyI CCWWGG 1 cut(s) 259
TaaI ACNGT 2 cut(s) 204, 253
TaiI ACGT 1 cut(s) 246
TaqI TCGA 3 cut(s) 7, 52, 61
TasI AATT 3 cut(s) 83, 138, 149
TfiI GAWTC 2 cut(s) 4, 49
Tru1I TTAA 5 cut(s) 68, 119, 141, 152, 268
Tru9I TTAA 5 cut(s) 68, 119, 141, 152, 268
TscAI CASTG 1 cut(s) 207
TspDTI ATGAA 2 cut(s) 17, 23
TspRI CASTG 1 cut(s) 207
XapI RAATTY 1 cut(s) 83
XspI CTAG 1 cut(s) 212
Zsp2I ATGCAT 1 cut(s) 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.