ATCG00600

Component of the cytochrome b6-f complex, which mediates electron transfer between photosystem II (PSII) and photosystem I (PSI), cyclic electron flow around PSI, and state transitions. PetG is required for either the stability or assembly of the cytochrome b6-f complex

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
Pt
OG0026884
Physical Location & Seq
Forward (+)
65998 .. 66111
114 bp
Loading structure...
UTR
Exon/CDS
Intron
ATCG00600.1

Sequence Viewer

Length: 114 bp
ATGATTGAAGTTTTTTTATTTGGAATCGTCTTAGGTCTAATTCCTATTACTTTGGCTGGATTATTCGTAACTGCTTATTTACAATACAGACGTGGTGATCAGTTGGACTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00195 ko01100 map00195 map01100
Pfam Domains
Protein Families
PetG

Protein Analysis

37

Amino Acids

4.2

Weight (kDa)

4.56

Isoelectric Point (pI)

27.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PetG PF02529 1 - 36 7.3e-23 Cytochrome B6-F complex subunit 5
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0026884)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00600
rosa_chinensis RchiOBHm_Chr2g0136521

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 8
AjiI CACGTC 1 cut(s) 92
AsuHPI GGTGA 1 cut(s) 107
BclI TGATCA 1 cut(s) 97
BmgBI CACGTC 1 cut(s) 92
Bsp143I GATC 1 cut(s) 97
BssMI GATC 1 cut(s) 97
BstDEI CTNAG 1 cut(s) 31
BstKTI GATC 1 cut(s) 100
BstMBI GATC 1 cut(s) 97
BtrI CACGTC 1 cut(s) 92
CviJI RGCY 1 cut(s) 56
CviKI_1 RGCY 1 cut(s) 56
DdeI CTNAG 1 cut(s) 31
DpnI GATC 1 cut(s) 99
DpnII GATC 1 cut(s) 97
FbaI TGATCA 1 cut(s) 97
FspEI CC 7 cut(s) 6, 18, 38, 42, 57, 78, 89
HinfI GANTC 1 cut(s) 24
HphI GGTGA 1 cut(s) 107
HpyCH4IV ACGT 1 cut(s) 91
HpyF3I CTNAG 1 cut(s) 31
HpySE526I ACGT 1 cut(s) 91
Ksp22I TGATCA 1 cut(s) 97
Kzo9I GATC 1 cut(s) 97
LpnPI CCDG 1 cut(s) 42
MaeII ACGT 1 cut(s) 91
MaeIII GTNAC 1 cut(s) 67
MalI GATC 1 cut(s) 99
MboI GATC 1 cut(s) 97
MluCI AATT 1 cut(s) 39
MmeI TCCRAC 1 cut(s) 84
MseI TTAA 1 cut(s) 112
NdeII GATC 1 cut(s) 97
PfeI GAWTC 1 cut(s) 24
SaqAI TTAA 1 cut(s) 112
Sau3AI GATC 1 cut(s) 97
SetI ASST 2 cut(s) 37, 94
SgeI CNNG 2 cut(s) 69, 104
Sse9I AATT 1 cut(s) 39
TaiI ACGT 1 cut(s) 94
TasI AATT 1 cut(s) 39
TfiI GAWTC 1 cut(s) 24
Tru1I TTAA 1 cut(s) 112
Tru9I TTAA 1 cut(s) 112
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.