Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0026884

Physical Location & Seq

Genomic Coordinates Forward (+)

53895713 .. 53895877

Gene Structure 165 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ50731

Sequence Viewer

CDS Protein Promoter (2k)

Length: 165 bp

ATGATTGAAGTTTTTCTATTTGGAATCGTCTTGGGTCTAATTCCTATGACTTTGGCTGGATTATTTGTAACTGCATACTTACAATACAGACCTGGTAGCCGTAATACCACAAAACCTACAGTATTTAGAATACTAATCATCCATCTGAAAATATCCAGTATATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00195 ko01100 map00195 map01100

Pfam Domains

Protein Families

PetG

Protein Analysis

54

Amino Acids

6.06

Weight (kDa)

10.43

Isoelectric Point (pI)

25.01

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
PetG	PF02529	1 - 33	1.5e-18	Cytochrome B6-F complex subunit 5

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0026884)

Species	Orthologous Gene IDs
arabidopsis_thaliana	ATCG00600
rosa_chinensis	RchiOBHm_Chr2g0136521

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	8
AjnI	CCWGG	1 cut(s)	91
Asp700I	GAANNNNTTC	1 cut(s)	12
BccI	CCATC	1 cut(s)	150
BceAI	ACGGC	1 cut(s)	84
BciT130I	CCWGG	1 cut(s)	93
BfmI	CTRYAG	1 cut(s)	117
Bme1390I	CCNGG	1 cut(s)	93
BmrFI	CCNGG	1 cut(s)	93
Bse1I	ACTGG	1 cut(s)	156
BseBI	CCWGG	1 cut(s)	93
BseGI	GGATG	1 cut(s)	138
BseNI	ACTGG	1 cut(s)	156
BsrI	ACTGG	1 cut(s)	156
Bst2UI	CCWGG	1 cut(s)	93
Bst4CI	ACNGT	1 cut(s)	121
BstF5I	GGATG	1 cut(s)	138
BstNI	CCWGG	1 cut(s)	93
BstSCI	CCNGG	1 cut(s)	91
BstSFI	CTRYAG	1 cut(s)	117
BtsCI	GGATG	1 cut(s)	138
CsiI	ACCWGGT	1 cut(s)	91
CviJI	RGCY	2 cut(s)	56, 99
CviKI_1	RGCY	2 cut(s)	56, 99
EcoRII	CCWGG	1 cut(s)	91
FaiI	YATR	4 cut(s)	47, 76, 161, 163
FokI	GGATG	1 cut(s)	125
HinfI	GANTC	1 cut(s)	24
Hpy188I	TCNGA	1 cut(s)	147
HpyCH4III	ACNGT	1 cut(s)	121
HpyCH4V	TGCA	1 cut(s)	74
LpnPI	CCDG	3 cut(s)	42, 78, 105
MabI	ACCWGGT	1 cut(s)	91
MaeIII	GTNAC	1 cut(s)	67
MluCI	AATT	1 cut(s)	39
MroXI	GAANNNNTTC	1 cut(s)	12
MspR9I	CCNGG	1 cut(s)	93
MvaI	CCWGG	1 cut(s)	93
PdmI	GAANNNNTTC	1 cut(s)	12
PfeI	GAWTC	1 cut(s)	24
Psp6I	CCWGG	1 cut(s)	91
PspGI	CCWGG	1 cut(s)	91
ScrFI	CCNGG	1 cut(s)	93
SetI	ASST	2 cut(s)	94, 118
SexAI	ACCWGGT	1 cut(s)	91
SfcI	CTRYAG	1 cut(s)	117
SgeI	CNNG	4 cut(s)	43, 69, 104, 105
Sse9I	AATT	1 cut(s)	39
StyD4I	CCNGG	1 cut(s)	91
TaaI	ACNGT	1 cut(s)	121
TasI	AATT	1 cut(s)	39
TfiI	GAWTC	1 cut(s)	24
XmnI	GAANNNNTTC	1 cut(s)	12

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.