Basic Information

Type: gene

Biological Identity

Species

arabidopsis_thaliana

Chromosome

Orthogroup ID

OG0026818

Physical Location & Seq

Genomic Coordinates Forward (+)

66929 .. 67063

Gene Structure 135 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

ATCG00630.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 135 bp

ATGCGAGATCTAAAAACATATCTTTCCGTAGCACCGGTACTAAGTACTCTATGGTTCGGTTCGTTAGCAGGTTTATTAATAGAGATTAATCGTTTATTTCCAGATGCATTAACATTTCCCTTTTTTTCATTCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009534 GO:0009535 GO:0009536 GO:0009579 GO:0016020 GO:0031976 GO:0031984 GO:0034357 GO:0042651 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044436 GO:0044444 GO:0044446 GO:0044464 GO:0055035

KEGG Pathways

Metabolic & Signaling

ko00195 ko01100 map00195 map01100

Pfam Domains

Protein Families

PSI_PsaJ

Protein Analysis

44

Amino Acids

5.01

Weight (kDa)

5.88

Isoelectric Point (pI)

48.85

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
PSI_PsaJ	PF01701	1 - 37	3e-20	Photosystem I reaction centre subunit IX / PsaJ

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0026818)

Species	Orthologous Gene IDs
arabidopsis_thaliana	ATCG00630
pyrus_communis	pycom12397g00200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	59
AfaI	GTAC	2 cut(s)	39, 46
AgeI	ACCGGT	1 cut(s)	34
AseI	ATTAAT	2 cut(s)	77, 87
AsiGI	ACCGGT	1 cut(s)	34
BfaI	CTAG	1 cut(s)	133
BfuAI	ACCTGC	1 cut(s)	59
BglII	AGATCT	1 cut(s)	7
BmcAI	AGTACT	1 cut(s)	46
BmsI	GCATC	1 cut(s)	94
BsaWI	WCCGGW	1 cut(s)	34
Bse118I	RCCGGY	1 cut(s)	34
BshTI	ACCGGT	1 cut(s)	34
BsiSI	CCGG	1 cut(s)	35
Bsp143I	GATC	1 cut(s)	7
BspMI	ACCTGC	1 cut(s)	59
BsrFI	RCCGGY	1 cut(s)	34
BssAI	RCCGGY	1 cut(s)	34
BssMI	GATC	1 cut(s)	7
BstDEI	CTNAG	1 cut(s)	41
BstKTI	GATC	1 cut(s)	10
BstMBI	GATC	1 cut(s)	7
BstX2I	RGATCY	1 cut(s)	7
BstYI	RGATCY	1 cut(s)	7
BveI	ACCTGC	1 cut(s)	59
Cfr10I	RCCGGY	1 cut(s)	34
Csp6I	GTAC	2 cut(s)	38, 45
CspAI	ACCGGT	1 cut(s)	34
CviQI	GTAC	2 cut(s)	38, 45
DdeI	CTNAG	1 cut(s)	41
DpnI	GATC	1 cut(s)	9
DpnII	GATC	1 cut(s)	7
EcoT22I	ATGCAT	1 cut(s)	109
FaiI	YATR	2 cut(s)	19, 52
FspBI	CTAG	1 cut(s)	133
FspEI	CC	7 cut(s)	20, 37, 40, 42, 48, 54, 114
HapII	CCGG	1 cut(s)	35
HpaII	CCGG	1 cut(s)	35
Hpy188III	TCNNGA	1 cut(s)	101
HpyCH4V	TGCA	1 cut(s)	107
HpyF3I	CTNAG	1 cut(s)	41
Kzo9I	GATC	1 cut(s)	7
LpnPI	CCDG	3 cut(s)	48, 54, 114
LweI	GCATC	1 cut(s)	94
MaeI	CTAG	1 cut(s)	133
MalI	GATC	1 cut(s)	9
MboI	GATC	1 cut(s)	7
MflI	RGATCY	1 cut(s)	7
Mph1103I	ATGCAT	1 cut(s)	109
MseI	TTAA	3 cut(s)	77, 87, 110
MspI	CCGG	1 cut(s)	35
NdeII	GATC	1 cut(s)	7
NsiI	ATGCAT	1 cut(s)	109
PinAI	ACCGGT	1 cut(s)	34
PshBI	ATTAAT	2 cut(s)	77, 87
PsuI	RGATCY	1 cut(s)	7
RsaI	GTAC	2 cut(s)	39, 46
RsaNI	GTAC	2 cut(s)	38, 45
SaqAI	TTAA	3 cut(s)	77, 87, 110
Sau3AI	GATC	1 cut(s)	7
ScaI	AGTACT	1 cut(s)	46
SetI	ASST	1 cut(s)	73
SfaNI	GCATC	1 cut(s)	94
SgeI	CNNG	4 cut(s)	17, 47, 81, 113
SspMI	CTAG	1 cut(s)	133
TatI	WGTACW	1 cut(s)	44
Tru1I	TTAA	3 cut(s)	77, 87, 110
Tru9I	TTAA	3 cut(s)	77, 87, 110
TspDTI	ATGAA	1 cut(s)	117
TspGWI	ACGGA	1 cut(s)	16
VspI	ATTAAT	2 cut(s)	77, 87
XspI	CTAG	1 cut(s)	133
ZrmI	AGTACT	1 cut(s)	46
Zsp2I	ATGCAT	1 cut(s)	109

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.