FvH4_2g19610
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
OG0022169
Physical Location & Seq
Forward (+)
16602686 .. 16603090
405 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g19610.t1

Sequence Viewer

Length: 297 bp
ATGAACACGCTCGTCTCTATTCGCCGGAATGTCTTTGAGATTGCCGGCACGCCAGTCGCTAGTGAATTTTGTTGTCCGGGGCAAGTTGACATGGAAATGCCAATTGAGGTCGCCACCAAGACCAAGAGTGTGGATGCCGAGATCGTCAACGTCGGACTTGCAGTGGACAACCAGTTGTCTTCCTCCACTCAAACCATTAACGATGTGCACATGCCAGTTGGTGGGATCAAGACCGGGCTATTTGGCAGAGGATTCCGGGCAGATGCTAAGTGCCAAAGCTTGAATTTAAACTGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRRNT_2 LRR_1 LRR_8 Pkinase Pkinase_Tyr

Protein Analysis

99

Amino Acids

10.46

Weight (kDa)

5.18

Isoelectric Point (pI)

35.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022169)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g19610
rosa_samantha Rh6AG281500 Rh6CG283800 Rh6DG276900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 221
AclWI GGATC 1 cut(s) 233
AcsI RAATTY 2 cut(s) 65, 283
AfiI CCNNNNNNNGG 1 cut(s) 221
AgsI TTSAA 1 cut(s) 283
AluBI AGCT 1 cut(s) 279
AluI AGCT 1 cut(s) 279
Alw21I GWGCWC 1 cut(s) 210
Alw26I GTCTC 1 cut(s) 19
Alw44I GTGCAC 1 cut(s) 206
AlwI GGATC 1 cut(s) 233
ApaLI GTGCAC 1 cut(s) 206
ApoI RAATTY 2 cut(s) 65, 283
AsuC2I CCSGG 3 cut(s) 78, 235, 257
BaeGI GKGCMC 1 cut(s) 210
BbsI GAAGAC 1 cut(s) 171
Bbv12I GWGCWC 1 cut(s) 210
BcgI CGANNNNNNTGC 2 cut(s) 37, 71
BcnI CCSGG 3 cut(s) 78, 235, 257
BcoDI GTCTC 1 cut(s) 19
BfaI CTAG 1 cut(s) 60
Bme1390I CCNGG 3 cut(s) 78, 235, 257
BmrFI CCNGG 3 cut(s) 78, 235, 257
BmsI GCATC 2 cut(s) 124, 253
BpiI GAAGAC 1 cut(s) 171
BpuMI CCSGG 3 cut(s) 78, 235, 257
BsaJI CCNNGG 1 cut(s) 77
Bsc4I CCNNNNNNNGG 1 cut(s) 221
Bse118I RCCGGY 1 cut(s) 44
Bse1I ACTGG 3 cut(s) 53, 172, 215
BseDI CCNNGG 1 cut(s) 77
BseGI GGATG 1 cut(s) 139
BseLI CCNNNNNNNGG 1 cut(s) 221
BseNI ACTGG 3 cut(s) 53, 172, 215
BseSI GKGCMC 1 cut(s) 210
BsiHKAI GWGCWC 1 cut(s) 210
BsiSI CCGG 5 cut(s) 25, 45, 77, 234, 256
BslI CCNNNNNNNGG 1 cut(s) 221
BsmAI GTCTC 1 cut(s) 19
BsmBI CGTCTC 1 cut(s) 19
Bsp1286I GDGCHC 1 cut(s) 210
Bsp143I GATC 2 cut(s) 141, 225
BspPI GGATC 1 cut(s) 233
BsrFI RCCGGY 1 cut(s) 44
BsrI ACTGG 3 cut(s) 53, 172, 215
BssAI RCCGGY 1 cut(s) 44
BssECI CCNNGG 1 cut(s) 77
BssMI GATC 2 cut(s) 141, 225
BstC8I GCNNGC 2 cut(s) 46, 50
BstDEI CTNAG 1 cut(s) 267
BstF5I GGATG 1 cut(s) 139
BstKTI GATC 2 cut(s) 144, 228
BstMAI GTCTC 1 cut(s) 19
BstMBI GATC 2 cut(s) 141, 225
BstNSI RCATGY 1 cut(s) 214
BstSCI CCNGG 3 cut(s) 76, 233, 255
BstSLI GKGCMC 1 cut(s) 210
BstV2I GAAGAC 1 cut(s) 171
BstXI CCANNNNNNTGG 1 cut(s) 130
BtsCI GGATG 1 cut(s) 139
BtsI GCAGTG 1 cut(s) 168
BtsIMutI CAGTG 1 cut(s) 168
Cac8I GCNNGC 2 cut(s) 46, 50
Cfr10I RCCGGY 1 cut(s) 44
CviAII CATG 2 cut(s) 91, 211
CviJI RGCY 2 cut(s) 238, 279
CviKI_1 RGCY 2 cut(s) 238, 279
DdeI CTNAG 1 cut(s) 267
DpnI GATC 2 cut(s) 143, 227
DpnII GATC 2 cut(s) 141, 225
DraI TTTAAA 1 cut(s) 288
Esp3I CGTCTC 1 cut(s) 19
FaeI CATG 2 cut(s) 94, 214
FaiI YATR 2 cut(s) 92, 212
FatI CATG 2 cut(s) 90, 210
FokI GGATG 1 cut(s) 146
FspBI CTAG 1 cut(s) 60
HapII CCGG 5 cut(s) 25, 45, 77, 234, 256
Hin1II CATG 2 cut(s) 94, 214
HincII GTYRAC 2 cut(s) 88, 148
HindII GTYRAC 2 cut(s) 88, 148
HindIII AAGCTT 1 cut(s) 277
HinfI GANTC 1 cut(s) 252
HpaII CCGG 5 cut(s) 25, 45, 77, 234, 256
Hpy166II GTNNAC 4 cut(s) 88, 148, 166, 208
Hpy188I TCNGA 1 cut(s) 155
Hpy188III TCNNGA 1 cut(s) 229
Hpy8I GTNNAC 4 cut(s) 88, 148, 166, 208
Hpy99I CGWCG 1 cut(s) 155
HpyCH4IV ACGT 1 cut(s) 150
HpyCH4V TGCA 2 cut(s) 161, 208
HpyF3I CTNAG 1 cut(s) 267
HpySE526I ACGT 1 cut(s) 150
Hsp92II CATG 2 cut(s) 94, 214
KroI GCCGGC 1 cut(s) 44
KroNI GCCGGC 1 cut(s) 46
Kzo9I GATC 2 cut(s) 141, 225
LpnPI CCDG 8 cut(s) 38, 58, 66, 90, 185, 228, 247, 269
LweI GCATC 2 cut(s) 124, 253
MaeI CTAG 1 cut(s) 60
MaeII ACGT 1 cut(s) 150
MalI GATC 2 cut(s) 143, 227
MboI GATC 2 cut(s) 141, 225
MboII GAAGA 1 cut(s) 171
MfeI CAATTG 1 cut(s) 102
MhlI GDGCHC 1 cut(s) 210
MluCI AATT 3 cut(s) 65, 102, 283
MmeI TCCRAC 1 cut(s) 133
MnlI CCTC 3 cut(s) 100, 193, 242
MroNI GCCGGC 1 cut(s) 44
MseI TTAA 2 cut(s) 198, 287
MslI CAYNNNNRTG 1 cut(s) 95
MspI CCGG 5 cut(s) 25, 45, 77, 234, 256
MspR9I CCNGG 3 cut(s) 78, 235, 257
MunI CAATTG 1 cut(s) 102
NaeI GCCGGC 1 cut(s) 46
NciI CCSGG 3 cut(s) 78, 235, 257
NdeII GATC 2 cut(s) 141, 225
NgoMIV GCCGGC 1 cut(s) 44
NlaIII CATG 2 cut(s) 94, 214
NmeAIII GCCGAG 1 cut(s) 163
NspI RCATGY 1 cut(s) 214
PdiI GCCGGC 1 cut(s) 46
PfeI GAWTC 1 cut(s) 252
PflMI CCANNNNNTGG 1 cut(s) 221
RseI CAYNNNNRTG 1 cut(s) 95
SaqAI TTAA 2 cut(s) 198, 287
Sau3AI GATC 2 cut(s) 141, 225
ScrFI CCNGG 3 cut(s) 78, 235, 257
SduI GDGCHC 1 cut(s) 210
SetI ASST 3 cut(s) 111, 153, 281
SfaNI GCATC 2 cut(s) 124, 253
SmiMI CAYNNNNRTG 1 cut(s) 95
Sse9I AATT 3 cut(s) 65, 102, 283
SspMI CTAG 1 cut(s) 60
StyD4I CCNGG 3 cut(s) 76, 233, 255
TaiI ACGT 1 cut(s) 153
TasI AATT 3 cut(s) 65, 102, 283
TfiI GAWTC 1 cut(s) 252
Tru1I TTAA 2 cut(s) 198, 287
Tru9I TTAA 2 cut(s) 198, 287
TscAI CASTG 1 cut(s) 168
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 168
Van91I CCANNNNNTGG 1 cut(s) 221
VneI GTGCAC 1 cut(s) 206
XapI RAATTY 2 cut(s) 65, 283
XceI RCATGY 1 cut(s) 214
XspI CTAG 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.