FvH4_3g18490

Olee1-like protein

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Forward (+)
11813300 .. 11814540
1241 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g18490.t1

Sequence Viewer

Length: 534 bp
ATGGCGAAGAACTTGGAAATCGTTGCAGTTTTTCTCACCTTGTCATGCTTGTTGTCTTTGGCCTATGCCGACGGTGACAATGGAGGCGACAAAACCAGCATCACTGTTGAGGGTTATGTATATTGTGACCCATGCCGTGTTCAGTTCCCAACCAGAGTCAGTAAACGGATATCCGGTGCTTTAGTAAGACTGGAATGCAGAAGTCGCGAAAATGAAACTGTCATCTACACCGACGATGCAACAACCGATGACAATGGATCCTATAAGCTTTTTGTGAATGAAGACTTCCAAGAACAGATATGTGAGGTGACAGCGATTAAAAGCAATACAGATGATTGCAATGAAAAATTTGACGCCATTGAAAGAGCTAGAGTTTTGATCACAAAAAAGAATGGCATTCAATCTGATCAGGCTCGTTATGCCAACCCTCTTGGGTTCATGAAGAAAGAAATTAGTGACGAGTGCAAAGAAGTTATTGAGGAATTATTCCCAGAAGACATGCCAGACGAATTTAAGAAAAAATTCGAGAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

178

Amino Acids

20.08

Weight (kDa)

4.6

Isoelectric Point (pI)

39.17

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pollen_Ole_e_1 PF01190 36 - 116 2.1e-16 Pollen protein Ole e 1 like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017264)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 207
AclWI GGATC 2 cut(s) 252, 265
AcsI RAATTY 3 cut(s) 347, 509, 521
AcyI GRCGYC 1 cut(s) 354
AgsI TTSAA 2 cut(s) 362, 401
AluBI AGCT 2 cut(s) 268, 368
AluI AGCT 2 cut(s) 268, 368
AlwI GGATC 2 cut(s) 252, 265
AoxI GGCC 1 cut(s) 60
ApoI RAATTY 3 cut(s) 347, 509, 521
Asp700I GAANNNNTTC 1 cut(s) 521
AsuHPI GGTGA 3 cut(s) 28, 86, 319
BamHI GGATCC 1 cut(s) 257
BbsI GAAGAC 2 cut(s) 288, 501
BceAI ACGGC 1 cut(s) 120
BclI TGATCA 2 cut(s) 378, 406
BfaI CTAG 1 cut(s) 369
BmiI GGNNCC 1 cut(s) 259
BmsI GCATC 2 cut(s) 108, 226
BpiI GAAGAC 2 cut(s) 288, 501
BsaHI GRCGYC 1 cut(s) 354
BsaWI WCCGGW 1 cut(s) 173
Bse1I ACTGG 1 cut(s) 195
Bse3DI GCAATG 1 cut(s) 346
BseMI GCAATG 1 cut(s) 346
BseNI ACTGG 1 cut(s) 195
Bsh1236I CGCG 1 cut(s) 207
BshFI GGCC 1 cut(s) 62
BsiSI CCGG 1 cut(s) 174
BsmI GAATGC 2 cut(s) 200, 396
BsnI GGCC 1 cut(s) 62
Bsp143I GATC 3 cut(s) 257, 378, 406
Bsp68I TCGCGA 1 cut(s) 207
BspANI GGCC 1 cut(s) 62
BspFNI CGCG 1 cut(s) 207
BspHI TCATGA 1 cut(s) 438
BspLI GGNNCC 1 cut(s) 259
BspPI GGATC 2 cut(s) 252, 265
BsrDI GCAATG 1 cut(s) 346
BsrI ACTGG 1 cut(s) 195
BssMI GATC 3 cut(s) 257, 378, 406
BssNI GRCGYC 1 cut(s) 354
Bst4CI ACNGT 3 cut(s) 74, 106, 220
BstACI GRCGYC 1 cut(s) 354
BstFNI CGCG 1 cut(s) 207
BstKTI GATC 3 cut(s) 260, 381, 409
BstMBI GATC 3 cut(s) 257, 378, 406
BstMWI GCNNNNNNNGC 2 cut(s) 204, 419
BstNSI RCATGY 1 cut(s) 502
BstUI CGCG 1 cut(s) 207
BstV2I GAAGAC 2 cut(s) 288, 501
BstX2I RGATCY 1 cut(s) 257
BstYI RGATCY 1 cut(s) 257
BsuRI GGCC 1 cut(s) 62
BtsIMutI CAGTG 1 cut(s) 102
BtuMI TCGCGA 1 cut(s) 207
CciI TCATGA 1 cut(s) 438
CseI GACGC 1 cut(s) 362
CviAII CATG 4 cut(s) 45, 132, 439, 499
CviJI RGCY 4 cut(s) 62, 268, 368, 413
CviKI_1 RGCY 4 cut(s) 62, 268, 368, 413
DpnI GATC 3 cut(s) 259, 380, 408
DpnII GATC 3 cut(s) 257, 378, 406
Eco32I GATATC 1 cut(s) 171
EcoRV GATATC 1 cut(s) 171
FaeI CATG 4 cut(s) 48, 135, 442, 502
FatI CATG 4 cut(s) 44, 131, 438, 498
FbaI TGATCA 2 cut(s) 378, 406
FspBI CTAG 1 cut(s) 369
HaeIII GGCC 1 cut(s) 62
HapII CCGG 1 cut(s) 174
HgaI GACGC 1 cut(s) 362
Hin1I GRCGYC 1 cut(s) 354
Hin1II CATG 4 cut(s) 48, 135, 442, 502
HindIII AAGCTT 1 cut(s) 266
HinfI GANTC 1 cut(s) 156
HpaII CCGG 1 cut(s) 174
HphI GGTGA 3 cut(s) 28, 86, 319
Hpy166II GTNNAC 1 cut(s) 164
Hpy188I TCNGA 1 cut(s) 406
Hpy188III TCNNGA 3 cut(s) 206, 439, 526
Hpy8I GTNNAC 1 cut(s) 164
Hpy99I CGWCG 2 cut(s) 74, 236
HpyCH4III ACNGT 3 cut(s) 74, 106, 220
HpyCH4V TGCA 5 cut(s) 26, 198, 239, 339, 465
HpyF10VI GCNNNNNNNGC 2 cut(s) 204, 419
Hsp92I GRCGYC 1 cut(s) 354
Hsp92II CATG 4 cut(s) 48, 135, 442, 502
Ksp22I TGATCA 2 cut(s) 378, 406
Kzo9I GATC 3 cut(s) 257, 378, 406
LpnPI CCDG 7 cut(s) 109, 166, 176, 187, 395, 504, 516
LweI GCATC 2 cut(s) 108, 226
MaeI CTAG 1 cut(s) 369
MaeIII GTNAC 4 cut(s) 74, 125, 307, 455
MalI GATC 3 cut(s) 259, 380, 408
MboI GATC 3 cut(s) 257, 378, 406
MboII GAAGA 4 cut(s) 19, 293, 454, 506
MflI RGATCY 1 cut(s) 257
MluCI AATT 5 cut(s) 347, 450, 482, 509, 521
MlyI GAGTC 1 cut(s) 165
MnlI CCTC 5 cut(s) 77, 103, 298, 438, 472
MroXI GAANNNNTTC 1 cut(s) 521
MseI TTAA 2 cut(s) 318, 513
MspI CCGG 1 cut(s) 174
Mva1269I GAATGC 2 cut(s) 200, 396
MvnI CGCG 1 cut(s) 207
MwoI GCNNNNNNNGC 2 cut(s) 204, 419
NdeII GATC 3 cut(s) 257, 378, 406
NlaIII CATG 4 cut(s) 48, 135, 442, 502
NlaIV GGNNCC 1 cut(s) 259
NmuCI GTSAC 4 cut(s) 74, 125, 307, 455
NruI TCGCGA 1 cut(s) 207
NspI RCATGY 1 cut(s) 502
PagI TCATGA 1 cut(s) 438
PctI GAATGC 2 cut(s) 200, 396
PdmI GAANNNNTTC 1 cut(s) 521
PleI GAGTC 1 cut(s) 164
PpsI GAGTC 1 cut(s) 164
PspN4I GGNNCC 1 cut(s) 259
PsuI RGATCY 1 cut(s) 257
RruI TCGCGA 1 cut(s) 207
SaqAI TTAA 2 cut(s) 318, 513
Sau3AI GATC 3 cut(s) 257, 378, 406
SchI GAGTC 1 cut(s) 165
SetI ASST 4 cut(s) 41, 270, 309, 370
SfaNI GCATC 2 cut(s) 108, 226
Sse9I AATT 5 cut(s) 347, 450, 482, 509, 521
SspMI CTAG 1 cut(s) 369
TaaI ACNGT 3 cut(s) 74, 106, 220
TaqI TCGA 1 cut(s) 525
TasI AATT 5 cut(s) 347, 450, 482, 509, 521
Tru1I TTAA 2 cut(s) 318, 513
Tru9I TTAA 2 cut(s) 318, 513
TscAI CASTG 1 cut(s) 109
TseFI GTSAC 4 cut(s) 74, 125, 307, 455
Tsp45I GTSAC 4 cut(s) 74, 125, 307, 455
TspDTI ATGAA 5 cut(s) 228, 294, 357, 427, 455
TspGWI ACGGA 1 cut(s) 181
TspRI CASTG 1 cut(s) 109
XapI RAATTY 3 cut(s) 347, 509, 521
XceI RCATGY 1 cut(s) 502
XmnI GAANNNNTTC 1 cut(s) 521
XspI CTAG 1 cut(s) 369
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.