FvH4_4g12203

FAR1-related protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
OG0024120
Physical Location & Seq
Forward (+)
15886386 .. 15891845
5460 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g12203.t1

Sequence Viewer

Length: 336 bp
ATGAAATTTGGAGAAGCTAGTTATCTGATGGAATATTTTTCAAAGCAGATGTTAGAAAATCCATCGTTCTTTTATGAGATGCAGTTGAACAGTGAGGACCAAATCACTAACATTTTTTGGGCCGATGCTAAAATGATAATGGATTATTGTATATTTGGAGATGTGGTAAGTTTTGATACAACTTACAAACTTAATGAAGCAAATCGACCATTTGCGGTCTTTGTTGGATTAAATCACCACAAAGAGACGGTTATATTTGGAGCTGCTCTAATGTACGACGAGATTGCTGCATCATTTATATGGTTGTTTGAAACCTTAGGAGTAGTGATAGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
FAR1 MULE SWIM

Protein Analysis

112

Amino Acids

12.92

Weight (kDa)

4.34

Isoelectric Point (pI)

31.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
MULE PF10551 55 - 106 3.9e-11 MULE transposase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024120)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g12203
rosa_multiflora Rmu_sc0004268.1_g000013
rosa_rugosa Rorug03G0294500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 215
AcsI RAATTY 1 cut(s) 5
AfaI GTAC 1 cut(s) 275
AgsI TTSAA 3 cut(s) 42, 88, 311
AluBI AGCT 2 cut(s) 17, 263
AluI AGCT 2 cut(s) 17, 263
Alw26I GTCTC 1 cut(s) 239
AoxI GGCC 1 cut(s) 120
ApeKI GCWGC 2 cut(s) 263, 287
ApoI RAATTY 1 cut(s) 5
AspS9I GGNCC 2 cut(s) 97, 120
AsuHPI GGTGA 1 cut(s) 227
AvaII GGWCC 1 cut(s) 97
AxyI CCTNAGG 1 cut(s) 316
BbvI GCAGC 2 cut(s) 250, 274
BccI CCATC 2 cut(s) 22, 70
BcgI CGANNNNNNTGC 4 cut(s) 266, 269, 300, 303
BcoDI GTCTC 1 cut(s) 239
BfaI CTAG 1 cut(s) 18
BisI GCNGC 2 cut(s) 264, 288
BlsI GCNGC 2 cut(s) 265, 289
Bme18I GGWCC 1 cut(s) 97
BmgT120I GGNCC 2 cut(s) 97, 120
BmsI GCATC 3 cut(s) 69, 115, 299
BsaXI ACNNNNNCTCC 2 cut(s) 150, 180
Bse21I CCTNAGG 1 cut(s) 316
BseXI GCAGC 2 cut(s) 250, 274
BshFI GGCC 1 cut(s) 122
BsmAI GTCTC 1 cut(s) 239
BsmBI CGTCTC 1 cut(s) 239
BsnI GGCC 1 cut(s) 122
BspACI CCGC 1 cut(s) 215
BspANI GGCC 1 cut(s) 122
Bst4CI ACNGT 2 cut(s) 92, 250
BstDEI CTNAG 1 cut(s) 316
BstMAI GTCTC 1 cut(s) 239
BstV1I GCAGC 2 cut(s) 250, 274
Bsu36I CCTNAGG 1 cut(s) 316
BsuRI GGCC 1 cut(s) 122
BtsIMutI CAGTG 1 cut(s) 97
Cfr13I GGNCC 2 cut(s) 97, 120
Csp6I GTAC 1 cut(s) 274
CviJI RGCY 3 cut(s) 17, 122, 263
CviKI_1 RGCY 3 cut(s) 17, 122, 263
CviQI GTAC 1 cut(s) 274
DdeI CTNAG 1 cut(s) 316
Eco47I GGWCC 1 cut(s) 97
Eco81I CCTNAGG 1 cut(s) 316
Esp3I CGTCTC 1 cut(s) 239
FaiI YATR 5 cut(s) 75, 152, 254, 299, 301
Fnu4HI GCNGC 2 cut(s) 264, 288
Fsp4HI GCNGC 2 cut(s) 264, 288
FspBI CTAG 1 cut(s) 18
GluI GCNGC 2 cut(s) 264, 288
HaeIII GGCC 1 cut(s) 122
HphI GGTGA 1 cut(s) 227
Hpy188I TCNGA 1 cut(s) 27
Hpy99I CGWCG 1 cut(s) 281
HpyCH4III ACNGT 2 cut(s) 92, 250
HpyCH4V TGCA 2 cut(s) 82, 290
HpyF3I CTNAG 1 cut(s) 316
LmnI GCTCC 1 cut(s) 260
Lsp1109I GCAGC 2 cut(s) 250, 274
LweI GCATC 3 cut(s) 69, 115, 299
MaeI CTAG 1 cut(s) 18
MluCI AATT 1 cut(s) 5
MmeI TCCRAC 1 cut(s) 205
MnlI CCTC 1 cut(s) 88
MseI TTAA 3 cut(s) 192, 230, 334
MslI CAYNNNNRTG 1 cut(s) 298
PkrI GCNGC 2 cut(s) 265, 289
PspPI GGNCC 2 cut(s) 97, 120
RsaI GTAC 1 cut(s) 275
RsaNI GTAC 1 cut(s) 274
RseI CAYNNNNRTG 1 cut(s) 298
SaqAI TTAA 3 cut(s) 192, 230, 334
SatI GCNGC 2 cut(s) 264, 288
Sau96I GGNCC 2 cut(s) 97, 120
SetI ASST 3 cut(s) 19, 265, 317
SfaNI GCATC 3 cut(s) 69, 115, 299
SgeI CNNG 2 cut(s) 30, 292
SinI GGWCC 1 cut(s) 97
SmiMI CAYNNNNRTG 1 cut(s) 298
Sse9I AATT 1 cut(s) 5
SsiI CCGC 1 cut(s) 215
SspI AATATT 1 cut(s) 35
SspMI CTAG 1 cut(s) 18
TaaI ACNGT 2 cut(s) 92, 250
TaqI TCGA 1 cut(s) 205
TasI AATT 1 cut(s) 5
Tru1I TTAA 3 cut(s) 192, 230, 334
Tru9I TTAA 3 cut(s) 192, 230, 334
TscAI CASTG 1 cut(s) 97
TseI GCWGC 2 cut(s) 263, 287
TspDTI ATGAA 2 cut(s) 17, 210
TspRI CASTG 1 cut(s) 97
VpaK11BI GGWCC 1 cut(s) 97
XapI RAATTY 1 cut(s) 5
XspI CTAG 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.