MD00G1023100.v1.1

Embryo-specific protein 3, (ATS3)

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
Physical Location & Seq
Reverse (-)
3873058 .. 3873547
490 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1023100.v1.1.491

Sequence Viewer

Length: 399 bp
ATGTCGGAAATAATATATTGCGTGACAGGCTTATACATGTTTGTAAATTTACATAGCGCGAACCTAAAAATGTCATCTAGATTGATGTCTGCCAACATAATCATCTGCAGTGTGTATTCGGGTAGAATTGATGATCCACAAAAAGGCAGATTCCGACGGTGTCGTATGGATACATTTGGTCATATTTTCGGGCCATGCACGTACCCTTGTTGTATGTTAGTCTACAGGACGGGATACGATGGGTGGAAAGTAGATACAGCGACAATTTTCGTTGATGCTAAATCTGTCACATTTTTTTTCAACTCGATGTATATCCCACAAGGTGTTTGGTATGGGCTTAATAATTGTATTGGTGCTCATGCGGCATCATCCCCTGAAAACACACAGAAAAGGATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

133

Amino Acids

14.98

Weight (kDa)

8.89

Isoelectric Point (pI)

48.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ATS3 PF06232 37 - 116 2e-17 Embryo-specific protein 3, (ATS3)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0028759)

Species Orthologous Gene IDs
malus_domestica MD00G1023100.v1.1
pyrus_communis pycom17g21460

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 222
AccII CGCG 1 cut(s) 59
AciI CCGC 1 cut(s) 362
AclWI GGATC 1 cut(s) 128
AcsI RAATTY 1 cut(s) 46
AdeI CACNNNGTG 1 cut(s) 323
AfaI GTAC 1 cut(s) 203
AfiI CCNNNNNNNGG 1 cut(s) 143
AflIII ACRYGT 1 cut(s) 36
AgsI TTSAA 1 cut(s) 301
Alw21I GWGCWC 1 cut(s) 358
AlwI GGATC 1 cut(s) 128
AoxI GGCC 1 cut(s) 191
ApoI RAATTY 1 cut(s) 46
AspLEI GCGC 1 cut(s) 59
AspS9I GGNCC 1 cut(s) 191
Bbv12I GWGCWC 1 cut(s) 358
BccI CCATC 1 cut(s) 233
BciVI GTATCC 2 cut(s) 163, 227
BfaI CTAG 1 cut(s) 78
BfmI CTRYAG 2 cut(s) 106, 223
BfuI GTATCC 2 cut(s) 163, 227
BisI GCNGC 1 cut(s) 363
BlsI GCNGC 1 cut(s) 364
BmgT120I GGNCC 1 cut(s) 191
BmsI GCATC 2 cut(s) 265, 374
BsaAI YACGTR 1 cut(s) 201
BsaBI GATNNNNATC 1 cut(s) 311
Bsc4I CCNNNNNNNGG 1 cut(s) 143
Bse8I GATNNNNATC 1 cut(s) 311
BseGI GGATG 1 cut(s) 368
BseJI GATNNNNATC 1 cut(s) 311
BseLI CCNNNNNNNGG 1 cut(s) 143
Bsh1236I CGCG 1 cut(s) 59
BshFI GGCC 1 cut(s) 193
BsiHKAI GWGCWC 1 cut(s) 358
BslI CCNNNNNNNGG 1 cut(s) 143
BsnI GGCC 1 cut(s) 193
Bsp1286I GDGCHC 1 cut(s) 358
Bsp143I GATC 1 cut(s) 133
BspACI CCGC 1 cut(s) 362
BspANI GGCC 1 cut(s) 193
BspFNI CGCG 1 cut(s) 59
BspMAI CTGCAG 1 cut(s) 110
BspPI GGATC 1 cut(s) 128
BssMI GATC 1 cut(s) 133
Bst4CI ACNGT 1 cut(s) 159
BstBAI YACGTR 1 cut(s) 201
BstF5I GGATG 1 cut(s) 368
BstFNI CGCG 1 cut(s) 59
BstHHI GCGC 1 cut(s) 59
BstKTI GATC 1 cut(s) 136
BstMBI GATC 1 cut(s) 133
BstMWI GCNNNNNNNGC 2 cut(s) 27, 362
BstNSI RCATGY 1 cut(s) 40
BstSFI CTRYAG 2 cut(s) 106, 223
BstUI CGCG 1 cut(s) 59
BsuI GTATCC 2 cut(s) 163, 227
BsuRI GGCC 1 cut(s) 193
BtsCI GGATG 1 cut(s) 368
BtsI GCAGTG 1 cut(s) 115
BtsIMutI CAGTG 1 cut(s) 115
CfoI GCGC 1 cut(s) 59
Cfr13I GGNCC 1 cut(s) 191
Csp6I GTAC 1 cut(s) 202
CviAII CATG 3 cut(s) 37, 195, 359
CviJI RGCY 3 cut(s) 30, 193, 337
CviKI_1 RGCY 3 cut(s) 30, 193, 337
CviQI GTAC 1 cut(s) 202
DpnI GATC 1 cut(s) 135
DpnII GATC 1 cut(s) 133
DraIII CACNNNGTG 1 cut(s) 323
FaeI CATG 3 cut(s) 40, 198, 362
FatI CATG 3 cut(s) 36, 194, 358
FblI GTMKAC 1 cut(s) 222
Fnu4HI GCNGC 1 cut(s) 363
FokI GGATG 1 cut(s) 355
Fsp4HI GCNGC 1 cut(s) 363
FspBI CTAG 1 cut(s) 78
GlaI GCGC 1 cut(s) 58
GluI GCNGC 1 cut(s) 363
HaeIII GGCC 1 cut(s) 193
HhaI GCGC 1 cut(s) 59
Hin1II CATG 3 cut(s) 40, 198, 362
Hin6I GCGC 1 cut(s) 57
HinP1I GCGC 1 cut(s) 57
HinfI GANTC 1 cut(s) 150
Hpy166II GTNNAC 1 cut(s) 223
Hpy188I TCNGA 2 cut(s) 7, 155
Hpy188III TCNNGA 1 cut(s) 78
Hpy8I GTNNAC 1 cut(s) 223
Hpy99I CGWCG 1 cut(s) 159
HpyCH4III ACNGT 1 cut(s) 159
HpyCH4IV ACGT 1 cut(s) 200
HpyCH4V TGCA 2 cut(s) 108, 198
HpyF10VI GCNNNNNNNGC 2 cut(s) 27, 362
HpySE526I ACGT 1 cut(s) 200
Hsp92II CATG 3 cut(s) 40, 198, 362
HspAI GCGC 1 cut(s) 57
Kzo9I GATC 1 cut(s) 133
LpnPI CCDG 3 cut(s) 12, 211, 387
LweI GCATC 2 cut(s) 265, 374
MaeI CTAG 1 cut(s) 78
MaeII ACGT 1 cut(s) 200
MaeIII GTNAC 2 cut(s) 22, 286
MalI GATC 1 cut(s) 135
MboI GATC 1 cut(s) 133
MhlI GDGCHC 1 cut(s) 358
MluCI AATT 4 cut(s) 46, 126, 264, 343
MmeI TCCRAC 1 cut(s) 178
MseI TTAA 1 cut(s) 339
MvnI CGCG 1 cut(s) 59
MwoI GCNNNNNNNGC 2 cut(s) 27, 362
NdeII GATC 1 cut(s) 133
NlaIII CATG 3 cut(s) 40, 198, 362
NmuCI GTSAC 2 cut(s) 22, 286
NspI RCATGY 1 cut(s) 40
PciI ACATGT 1 cut(s) 36
PfeI GAWTC 1 cut(s) 150
PflFI GACNNNGTC 1 cut(s) 159
PkrI GCNGC 1 cut(s) 364
Ppu21I YACGTR 1 cut(s) 201
PscI ACATGT 1 cut(s) 36
PspPI GGNCC 1 cut(s) 191
PstI CTGCAG 1 cut(s) 110
PsyI GACNNNGTC 1 cut(s) 159
RsaI GTAC 1 cut(s) 203
RsaNI GTAC 1 cut(s) 202
SaqAI TTAA 1 cut(s) 339
SatI GCNGC 1 cut(s) 363
Sau3AI GATC 1 cut(s) 133
Sau96I GGNCC 1 cut(s) 191
SduI GDGCHC 1 cut(s) 358
SetI ASST 3 cut(s) 66, 203, 325
SfaNI GCATC 2 cut(s) 265, 374
SfcI CTRYAG 2 cut(s) 106, 223
Sse9I AATT 4 cut(s) 46, 126, 264, 343
SsiI CCGC 1 cut(s) 362
SspMI CTAG 1 cut(s) 78
TaaI ACNGT 1 cut(s) 159
TaiI ACGT 1 cut(s) 203
TaqI TCGA 1 cut(s) 305
TasI AATT 4 cut(s) 46, 126, 264, 343
TauI GCSGC 1 cut(s) 365
TfiI GAWTC 1 cut(s) 150
Tru1I TTAA 1 cut(s) 339
Tru9I TTAA 1 cut(s) 339
TscAI CASTG 1 cut(s) 115
TseFI GTSAC 2 cut(s) 22, 286
Tsp45I GTSAC 2 cut(s) 22, 286
TspRI CASTG 1 cut(s) 115
Tth111I GACNNNGTC 1 cut(s) 159
XapI RAATTY 1 cut(s) 46
XbaI TCTAGA 1 cut(s) 77
XceI RCATGY 1 cut(s) 40
XcmI CCANNNNNNNNNTGG 1 cut(s) 324
XmiI GTMKAC 1 cut(s) 222
XspI CTAG 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.