pycom17g21460

Embryo-specific protein 3, (ATS3)

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Reverse (-)
19810929 .. 19811228
300 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g21460.1

Sequence Viewer

Length: 300 bp
ATGATGATCAGGTGTATTCAGGTAGAATTGATCGATCCACAAAAAGGCAGATTCCGACGGTGTCGTATGGATACATTTGGTCATATTTTCGGGCCATGCACGTACCCTTGTTGTATGTTATTCTACAGGACGGGATACGATGGGTGGAAAGTAGATACAGCGACAATTTTCGTTGATGCTAAATCTGTCACATTTTTTTTCAACTCGATGTATATCCCACAAGGTGTTTGGTATGGGCTTAATAATTGTATTGGCGCTGATGCGGCATCATCCCCTGAAAACACACACAAAAAGATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.39

Weight (kDa)

8.58

Isoelectric Point (pI)

34.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ATS3 PF06232 9 - 83 8.4e-16 Embryo-specific protein 3, (ATS3)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0028759)

Species Orthologous Gene IDs
malus_domestica MD00G1023100.v1.1
pyrus_communis pycom17g21460

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 263
AclWI GGATC 1 cut(s) 29
AdeI CACNNNGTG 1 cut(s) 224
AfaI GTAC 1 cut(s) 104
AfiI CCNNNNNNNGG 1 cut(s) 44
AgsI TTSAA 1 cut(s) 202
AlwI GGATC 1 cut(s) 29
AoxI GGCC 1 cut(s) 92
AspLEI GCGC 1 cut(s) 257
AspS9I GGNCC 1 cut(s) 92
BccI CCATC 1 cut(s) 134
BciVI GTATCC 2 cut(s) 64, 128
BclI TGATCA 1 cut(s) 6
BfmI CTRYAG 1 cut(s) 124
BfoI RGCGCY 1 cut(s) 258
BfuI GTATCC 2 cut(s) 64, 128
BisI GCNGC 1 cut(s) 264
BlsI GCNGC 1 cut(s) 265
BmgT120I GGNCC 1 cut(s) 92
BmsI GCATC 3 cut(s) 166, 250, 275
Bsa29I ATCGAT 1 cut(s) 33
BsaAI YACGTR 1 cut(s) 102
BsaBI GATNNNNATC 1 cut(s) 212
Bsc4I CCNNNNNNNGG 1 cut(s) 44
Bse8I GATNNNNATC 1 cut(s) 212
BseCI ATCGAT 1 cut(s) 33
BseGI GGATG 1 cut(s) 269
BseJI GATNNNNATC 1 cut(s) 212
BseLI CCNNNNNNNGG 1 cut(s) 44
BshFI GGCC 1 cut(s) 94
BshVI ATCGAT 1 cut(s) 33
BslI CCNNNNNNNGG 1 cut(s) 44
BsnI GGCC 1 cut(s) 94
Bsp143I GATC 3 cut(s) 6, 30, 34
BspACI CCGC 1 cut(s) 263
BspANI GGCC 1 cut(s) 94
BspDI ATCGAT 1 cut(s) 33
BspPI GGATC 1 cut(s) 29
BssMI GATC 3 cut(s) 6, 30, 34
Bst4CI ACNGT 1 cut(s) 60
BstBAI YACGTR 1 cut(s) 102
BstF5I GGATG 1 cut(s) 269
BstH2I RGCGCY 1 cut(s) 258
BstHHI GCGC 1 cut(s) 257
BstKTI GATC 3 cut(s) 9, 33, 37
BstMBI GATC 3 cut(s) 6, 30, 34
BstMWI GCNNNNNNNGC 1 cut(s) 263
BstSFI CTRYAG 1 cut(s) 124
Bsu15I ATCGAT 1 cut(s) 33
BsuI GTATCC 2 cut(s) 64, 128
BsuRI GGCC 1 cut(s) 94
BsuTUI ATCGAT 1 cut(s) 33
BtsCI GGATG 1 cut(s) 269
CfoI GCGC 1 cut(s) 257
Cfr13I GGNCC 1 cut(s) 92
ClaI ATCGAT 1 cut(s) 33
Csp6I GTAC 1 cut(s) 103
CviAII CATG 1 cut(s) 96
CviJI RGCY 2 cut(s) 94, 238
CviKI_1 RGCY 2 cut(s) 94, 238
CviQI GTAC 1 cut(s) 103
DpnI GATC 3 cut(s) 8, 32, 36
DpnII GATC 3 cut(s) 6, 30, 34
DraIII CACNNNGTG 1 cut(s) 224
FaeI CATG 1 cut(s) 99
FaiI YATR 7 cut(s) 68, 84, 97, 116, 213, 234, 298
FatI CATG 1 cut(s) 95
FbaI TGATCA 1 cut(s) 6
Fnu4HI GCNGC 1 cut(s) 264
FokI GGATG 1 cut(s) 256
Fsp4HI GCNGC 1 cut(s) 264
GlaI GCGC 1 cut(s) 256
GluI GCNGC 1 cut(s) 264
HaeII RGCGCY 1 cut(s) 258
HaeIII GGCC 1 cut(s) 94
HhaI GCGC 1 cut(s) 257
Hin1II CATG 1 cut(s) 99
Hin6I GCGC 1 cut(s) 255
HinP1I GCGC 1 cut(s) 255
HinfI GANTC 1 cut(s) 51
Hpy188I TCNGA 1 cut(s) 56
Hpy99I CGWCG 1 cut(s) 60
HpyCH4III ACNGT 1 cut(s) 60
HpyCH4IV ACGT 1 cut(s) 101
HpyCH4V TGCA 1 cut(s) 99
HpyF10VI GCNNNNNNNGC 1 cut(s) 263
HpySE526I ACGT 1 cut(s) 101
Hsp92II CATG 1 cut(s) 99
HspAI GCGC 1 cut(s) 255
Ksp22I TGATCA 1 cut(s) 6
Kzo9I GATC 3 cut(s) 6, 30, 34
LpnPI CCDG 3 cut(s) 5, 112, 288
LweI GCATC 3 cut(s) 166, 250, 275
MaeII ACGT 1 cut(s) 101
MaeIII GTNAC 1 cut(s) 187
MalI GATC 3 cut(s) 8, 32, 36
MboI GATC 3 cut(s) 6, 30, 34
MluCI AATT 3 cut(s) 26, 165, 244
MmeI TCCRAC 1 cut(s) 79
MseI TTAA 1 cut(s) 240
MwoI GCNNNNNNNGC 1 cut(s) 263
NdeII GATC 3 cut(s) 6, 30, 34
NlaIII CATG 1 cut(s) 99
NmuCI GTSAC 1 cut(s) 187
PfeI GAWTC 1 cut(s) 51
PflFI GACNNNGTC 1 cut(s) 60
PkrI GCNGC 1 cut(s) 265
Ppu21I YACGTR 1 cut(s) 102
PspPI GGNCC 1 cut(s) 92
PsyI GACNNNGTC 1 cut(s) 60
RsaI GTAC 1 cut(s) 104
RsaNI GTAC 1 cut(s) 103
SaqAI TTAA 1 cut(s) 240
SatI GCNGC 1 cut(s) 264
Sau3AI GATC 3 cut(s) 6, 30, 34
Sau96I GGNCC 1 cut(s) 92
SetI ASST 4 cut(s) 14, 24, 104, 226
SfaNI GCATC 3 cut(s) 166, 250, 275
SfcI CTRYAG 1 cut(s) 124
Sse9I AATT 3 cut(s) 26, 165, 244
SsiI CCGC 1 cut(s) 263
TaaI ACNGT 1 cut(s) 60
TaiI ACGT 1 cut(s) 104
TaqI TCGA 2 cut(s) 33, 206
TasI AATT 3 cut(s) 26, 165, 244
TauI GCSGC 1 cut(s) 266
TfiI GAWTC 1 cut(s) 51
Tru1I TTAA 1 cut(s) 240
Tru9I TTAA 1 cut(s) 240
TseFI GTSAC 1 cut(s) 187
Tsp45I GTSAC 1 cut(s) 187
Tth111I GACNNNGTC 1 cut(s) 60
XcmI CCANNNNNNNNNTGG 1 cut(s) 225
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.