MD00G1036900.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
OG0022413
Physical Location & Seq
Reverse (-)
6518153 .. 6527857
9705 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1036900.v1.1.491

Sequence Viewer

Length: 222 bp
ATGAGACTGGGCCATTCTCTTCATTGTCAGGAACAATCAAGCAGAGACAGTGTGGCATTGCAAATCGTAATCCAAGTTGATCGATTTCGGTTCCAGGAAGAACAAATACAAGCTTTTGTTCACAAGGACATCAAATCAGACTCGGTCGTTTTCATTCTCGGTGAAGAGCATTTTGGACAAGCCTTACGAGCTCAAGAATTCGATCATCGAACAAGACAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.61

Weight (kDa)

6.17

Isoelectric Point (pI)

53.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022413)

Species Orthologous Gene IDs
malus_domestica MD00G1036900.v1.1
pyrus_communis pycom06g01700 pycom1134g00010 pycom17g05640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 197
AjnI CCWGG 1 cut(s) 93
AjuI GAANNNNNNNTTGG 2 cut(s) 156, 188
AluBI AGCT 2 cut(s) 113, 191
AluI AGCT 2 cut(s) 113, 191
Alw21I GWGCWC 1 cut(s) 193
Alw26I GTCTC 1 cut(s) 39
AoxI GGCC 1 cut(s) 10
ApoI RAATTY 1 cut(s) 197
AspS9I GGNCC 1 cut(s) 10
AsuHPI GGTGA 1 cut(s) 173
BanII GRGCYC 1 cut(s) 193
BarI GAAGNNNNNNTAC 2 cut(s) 90, 122
Bbv12I GWGCWC 1 cut(s) 193
BciT130I CCWGG 1 cut(s) 95
BcoDI GTCTC 1 cut(s) 39
Bme1390I CCNGG 1 cut(s) 95
BmgT120I GGNCC 1 cut(s) 10
BmiI GGNNCC 1 cut(s) 92
BmrFI CCNGG 1 cut(s) 95
BmrI ACTGGG 1 cut(s) 17
BmuI ACTGGG 1 cut(s) 17
BpuEI CTTGAG 1 cut(s) 177
Bsa29I ATCGAT 1 cut(s) 82
Bse1I ACTGG 1 cut(s) 12
Bse3DI GCAATG 1 cut(s) 56
BseBI CCWGG 1 cut(s) 95
BseCI ATCGAT 1 cut(s) 82
BseMI GCAATG 1 cut(s) 56
BseNI ACTGG 1 cut(s) 12
Bsh1285I CGRYCG 1 cut(s) 147
BshFI GGCC 1 cut(s) 12
BshVI ATCGAT 1 cut(s) 82
BsiEI CGRYCG 1 cut(s) 147
BsiHKAI GWGCWC 1 cut(s) 193
BsmAI GTCTC 1 cut(s) 39
BsnI GGCC 1 cut(s) 12
Bsp1286I GDGCHC 1 cut(s) 193
Bsp143I GATC 2 cut(s) 79, 202
BspANI GGCC 1 cut(s) 12
BspDI ATCGAT 1 cut(s) 82
BspLI GGNNCC 1 cut(s) 92
BspQI GCTCTTC 1 cut(s) 159
BsrDI GCAATG 1 cut(s) 56
BsrI ACTGG 1 cut(s) 12
BssMI GATC 2 cut(s) 79, 202
Bst2UI CCWGG 1 cut(s) 95
Bst4CI ACNGT 1 cut(s) 50
Bst6I CTCTTC 2 cut(s) 24, 159
BstKTI GATC 2 cut(s) 82, 205
BstMAI GTCTC 1 cut(s) 39
BstMBI GATC 2 cut(s) 79, 202
BstMCI CGRYCG 1 cut(s) 147
BstMWI GCNNNNNNNGC 1 cut(s) 188
BstNI CCWGG 1 cut(s) 95
BstSCI CCNGG 1 cut(s) 93
Bsu15I ATCGAT 1 cut(s) 82
BsuRI GGCC 1 cut(s) 12
BsuTUI ATCGAT 1 cut(s) 82
BtsIMutI CAGTG 1 cut(s) 55
Cfr13I GGNCC 1 cut(s) 10
ClaI ATCGAT 1 cut(s) 82
CviJI RGCY 4 cut(s) 12, 113, 182, 191
CviKI_1 RGCY 4 cut(s) 12, 113, 182, 191
DpnI GATC 2 cut(s) 81, 204
DpnII GATC 2 cut(s) 79, 202
Eam1104I CTCTTC 2 cut(s) 24, 159
EarI CTCTTC 2 cut(s) 24, 159
Ecl136II GAGCTC 1 cut(s) 191
Eco24I GRGCYC 1 cut(s) 193
Eco53kI GAGCTC 1 cut(s) 191
EcoICRI GAGCTC 1 cut(s) 191
EcoRI GAATTC 1 cut(s) 197
EcoRII CCWGG 1 cut(s) 93
EcoT38I GRGCYC 1 cut(s) 193
FriOI GRGCYC 1 cut(s) 193
HaeIII GGCC 1 cut(s) 12
HindIII AAGCTT 1 cut(s) 111
HinfI GANTC 1 cut(s) 140
HphI GGTGA 1 cut(s) 173
Hpy166II GTNNAC 1 cut(s) 121
Hpy188I TCNGA 1 cut(s) 139
Hpy188III TCNNGA 2 cut(s) 29, 194
Hpy8I GTNNAC 1 cut(s) 121
HpyCH4III ACNGT 1 cut(s) 50
HpyCH4V TGCA 1 cut(s) 61
HpyF10VI GCNNNNNNNGC 1 cut(s) 188
Kzo9I GATC 2 cut(s) 79, 202
LguI GCTCTTC 1 cut(s) 159
LpnPI CCDG 3 cut(s) 14, 80, 107
MalI GATC 2 cut(s) 81, 204
MboI GATC 2 cut(s) 79, 202
MboII GAAGA 3 cut(s) 11, 110, 176
MhlI GDGCHC 1 cut(s) 193
MluCI AATT 1 cut(s) 197
MlyI GAGTC 1 cut(s) 134
MspR9I CCNGG 1 cut(s) 95
MvaI CCWGG 1 cut(s) 95
MwoI GCNNNNNNNGC 1 cut(s) 188
NdeII GATC 2 cut(s) 79, 202
NlaIV GGNNCC 1 cut(s) 92
PciSI GCTCTTC 1 cut(s) 159
PflFI GACNNNGTC 1 cut(s) 143
PfoI TCCNGGA 1 cut(s) 93
PleI GAGTC 1 cut(s) 134
PpsI GAGTC 1 cut(s) 134
Psp124BI GAGCTC 1 cut(s) 193
Psp6I CCWGG 1 cut(s) 93
PspGI CCWGG 1 cut(s) 93
PspN4I GGNNCC 1 cut(s) 92
PspPI GGNCC 1 cut(s) 10
PsyI GACNNNGTC 1 cut(s) 143
SacI GAGCTC 1 cut(s) 193
SapI GCTCTTC 1 cut(s) 159
Sau3AI GATC 2 cut(s) 79, 202
Sau96I GGNCC 1 cut(s) 10
SchI GAGTC 1 cut(s) 134
ScrFI CCNGG 1 cut(s) 95
SduI GDGCHC 1 cut(s) 193
SetI ASST 2 cut(s) 115, 193
SmlI CTYRAG 1 cut(s) 192
SmoI CTYRAG 1 cut(s) 192
Sse9I AATT 1 cut(s) 197
SstI GAGCTC 1 cut(s) 193
StyD4I CCNGG 1 cut(s) 93
TaaI ACNGT 1 cut(s) 50
TaqI TCGA 3 cut(s) 82, 201, 208
TaqII GACCGA 1 cut(s) 133
TasI AATT 1 cut(s) 197
TscAI CASTG 1 cut(s) 55
TspDTI ATGAA 2 cut(s) 11, 142
TspRI CASTG 1 cut(s) 55
Tth111I GACNNNGTC 1 cut(s) 143
XapI RAATTY 1 cut(s) 197
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.