pycom06g01700

Phosphorylase is an important allosteric enzyme in carbohydrate metabolism. Enzymes from different sources differ in their regulatory mechanisms and in their natural substrates. However, all known phosphorylases share catalytic and structural properties

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr6
Physical Location & Seq
Forward (+)
2083576 .. 2083930
355 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom06g01700.1

Sequence Viewer

Length: 189 bp
ATGGGCCATTCTCTTCATTGTCAGGAACGATCAAGCGGAGCAGAGACAGTGTGGCATTGCAAATCGCAATCTAAACTGATCGATTTCGGTTCCAGGAAGAACAAATACAAGCTTTTGTTCACAAGGACATCGAATCGGACTTGGTCGTCTTCGTTCTCAATGAAGAGCGTTCTGGACAAGCCTTATTAG

Protein Analysis

63

Amino Acids

7.2

Weight (kDa)

9.94

Isoelectric Point (pI)

38.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022413)

Species Orthologous Gene IDs
malus_domestica MD00G1036900.v1.1
pyrus_communis pycom06g01700 pycom1134g00010 pycom17g05640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 145
AciI CCGC 1 cut(s) 36
AjnI CCWGG 1 cut(s) 92
AluBI AGCT 1 cut(s) 112
AluI AGCT 1 cut(s) 112
Alw26I GTCTC 1 cut(s) 38
AoxI GGCC 1 cut(s) 4
AspS9I GGNCC 1 cut(s) 4
BarI GAAGNNNNNNTAC 2 cut(s) 89, 121
BbsI GAAGAC 1 cut(s) 141
BciT130I CCWGG 1 cut(s) 94
BcoDI GTCTC 1 cut(s) 38
Bme1390I CCNGG 1 cut(s) 94
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 1 cut(s) 91
BmrFI CCNGG 1 cut(s) 94
BpiI GAAGAC 1 cut(s) 141
Bsa29I ATCGAT 1 cut(s) 81
Bse3DI GCAATG 1 cut(s) 55
BseBI CCWGG 1 cut(s) 94
BseCI ATCGAT 1 cut(s) 81
BseMI GCAATG 1 cut(s) 55
BshFI GGCC 1 cut(s) 6
BshVI ATCGAT 1 cut(s) 81
BsmAI GTCTC 1 cut(s) 38
BsnI GGCC 1 cut(s) 6
Bsp143I GATC 2 cut(s) 29, 78
BspACI CCGC 1 cut(s) 36
BspANI GGCC 1 cut(s) 6
BspDI ATCGAT 1 cut(s) 81
BspLI GGNNCC 1 cut(s) 91
BspQI GCTCTTC 1 cut(s) 158
BsrDI GCAATG 1 cut(s) 55
BssMI GATC 2 cut(s) 29, 78
Bst2UI CCWGG 1 cut(s) 94
Bst4CI ACNGT 1 cut(s) 49
Bst6I CTCTTC 2 cut(s) 18, 158
BstKTI GATC 2 cut(s) 32, 81
BstMAI GTCTC 1 cut(s) 38
BstMBI GATC 2 cut(s) 29, 78
BstNI CCWGG 1 cut(s) 94
BstSCI CCNGG 1 cut(s) 92
BstV2I GAAGAC 1 cut(s) 141
Bsu15I ATCGAT 1 cut(s) 81
BsuRI GGCC 1 cut(s) 6
BsuTUI ATCGAT 1 cut(s) 81
BtsIMutI CAGTG 1 cut(s) 54
Cfr13I GGNCC 1 cut(s) 4
ClaI ATCGAT 1 cut(s) 81
CviJI RGCY 3 cut(s) 6, 112, 181
CviKI_1 RGCY 3 cut(s) 6, 112, 181
DpnI GATC 2 cut(s) 31, 80
DpnII GATC 2 cut(s) 29, 78
DrdI GACNNNNNNGTC 1 cut(s) 145
DseDI GACNNNNNNGTC 1 cut(s) 145
Eam1104I CTCTTC 2 cut(s) 18, 158
EarI CTCTTC 2 cut(s) 18, 158
EcoRII CCWGG 1 cut(s) 92
HaeIII GGCC 1 cut(s) 6
HindIII AAGCTT 1 cut(s) 110
HinfI GANTC 1 cut(s) 133
Hpy166II GTNNAC 1 cut(s) 120
Hpy188I TCNGA 1 cut(s) 138
Hpy188III TCNNGA 2 cut(s) 23, 173
Hpy8I GTNNAC 1 cut(s) 120
HpyCH4III ACNGT 1 cut(s) 49
HpyCH4V TGCA 1 cut(s) 60
Kzo9I GATC 2 cut(s) 29, 78
LguI GCTCTTC 1 cut(s) 158
LmnI GCTCC 1 cut(s) 38
LpnPI CCDG 4 cut(s) 8, 79, 106, 158
MalI GATC 2 cut(s) 31, 80
MboI GATC 2 cut(s) 29, 78
MboII GAAGA 4 cut(s) 5, 109, 141, 175
MspR9I CCNGG 1 cut(s) 94
MvaI CCWGG 1 cut(s) 94
NdeII GATC 2 cut(s) 29, 78
NlaIV GGNNCC 1 cut(s) 91
PciSI GCTCTTC 1 cut(s) 158
PfeI GAWTC 1 cut(s) 133
PflFI GACNNNGTC 1 cut(s) 142
PfoI TCCNGGA 1 cut(s) 92
Psp6I CCWGG 1 cut(s) 92
PspGI CCWGG 1 cut(s) 92
PspN4I GGNNCC 1 cut(s) 91
PspPI GGNCC 1 cut(s) 4
PsyI GACNNNGTC 1 cut(s) 142
SapI GCTCTTC 1 cut(s) 158
Sau3AI GATC 2 cut(s) 29, 78
Sau96I GGNCC 1 cut(s) 4
ScrFI CCNGG 1 cut(s) 94
SetI ASST 1 cut(s) 114
SgeI CNNG 8 cut(s) 35, 45, 105, 106, 121, 135, 153, 185
SsiI CCGC 1 cut(s) 36
StyD4I CCNGG 1 cut(s) 92
TaaI ACNGT 1 cut(s) 49
TaqI TCGA 2 cut(s) 81, 131
TfiI GAWTC 1 cut(s) 133
TscAI CASTG 1 cut(s) 54
TspDTI ATGAA 2 cut(s) 5, 176
TspRI CASTG 1 cut(s) 54
Tth111I GACNNNGTC 1 cut(s) 142
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.