MD01G1070900.v1.1

G-type lectin S-receptor-like serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr01
OG0028631
Physical Location & Seq
Forward (+)
17542689 .. 17543075
387 bp
Loading structure...
UTR
Exon/CDS
Intron
MD01G1070900.v1.1.491

Sequence Viewer

Length: 387 bp
ATGGATACGAAAATTCTACTCTGCTATACATTGAGATTTTTGTTATGTTGTACCTTCATTGCTTGTATTTCCACGGCGTCTCACACCATCTCTCCAGGCCAATCTCTCTCCGAGGCACAAACAATCACCTCTCCAAGTGGAACATTTGAGCTCGGTTTCTTCAGACCACGTATACCTCCAAAGTATTACATAGGCATTTGGTACACAAATCAAAGTAGTCAAACCATTAAGACCGTAGTTTGGGTCGCAAACAGAAAACAACCTGTTTTTGAACCGAAACTTTCAGTATTAGAACTTGCCAAAAATGGAAACTTGACCTTAAGTAGCCCTCCAAAGTTGCAATATGGTCGACTAATTCAAGATCAAAGGTCTCTAATTCTAGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
B_lectin PAN_2 Pkinase S_locus_glycop

Protein Analysis

129

Amino Acids

14.4

Weight (kDa)

9.51

Isoelectric Point (pI)

52.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
B_lectin PF01453 78 - 109 3.9e-06 D-mannose binding lectin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0028631)

Species Orthologous Gene IDs
malus_domestica MD01G1070900.v1.1
pyrus_communis pycom14g03010

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 172, 349
AcsI RAATTY 1 cut(s) 12
AcuI CTGAAG 1 cut(s) 145
AcyI GRCGYC 1 cut(s) 77
AfaI GTAC 2 cut(s) 52, 203
AfiI CCNNNNNNNGG 1 cut(s) 240
AflII CTTAAG 1 cut(s) 319
AgsI TTSAA 2 cut(s) 272, 359
AjnI CCWGG 1 cut(s) 94
AluBI AGCT 1 cut(s) 151
AluI AGCT 1 cut(s) 151
Alw21I GWGCWC 1 cut(s) 153
Alw26I GTCTC 2 cut(s) 84, 375
AoxI GGCC 1 cut(s) 97
ApoI RAATTY 1 cut(s) 12
AsuHPI GGTGA 1 cut(s) 118
BanII GRGCYC 1 cut(s) 153
Bbv12I GWGCWC 1 cut(s) 153
BccI CCATC 1 cut(s) 95
BceAI ACGGC 1 cut(s) 90
BcgI CGANNNNNNTGC 2 cut(s) 329, 363
BciT130I CCWGG 1 cut(s) 96
BcoDI GTCTC 2 cut(s) 84, 375
BfaI CTAG 1 cut(s) 380
BfrI CTTAAG 1 cut(s) 319
Bme1390I CCNGG 1 cut(s) 96
BmrFI CCNGG 1 cut(s) 96
BpmI CTGGAG 1 cut(s) 78
BsaAI YACGTR 1 cut(s) 170
BsaHI GRCGYC 1 cut(s) 77
BsaI GGTCTC 1 cut(s) 375
BsaJI CCNNGG 2 cut(s) 72, 111
BsaXI ACNNNNNCTCC 2 cut(s) 76, 106
Bsc4I CCNNNNNNNGG 1 cut(s) 240
Bse3DI GCAATG 1 cut(s) 57
BseBI CCWGG 1 cut(s) 96
BseDI CCNNGG 2 cut(s) 72, 111
BseLI CCNNNNNNNGG 1 cut(s) 240
BseMI GCAATG 1 cut(s) 57
BshFI GGCC 1 cut(s) 99
BsiHKAI GWGCWC 1 cut(s) 153
BslI CCNNNNNNNGG 1 cut(s) 240
BsmAI GTCTC 2 cut(s) 84, 375
BsmBI CGTCTC 1 cut(s) 84
BsnI GGCC 1 cut(s) 99
Bso31I GGTCTC 1 cut(s) 375
Bsp1286I GDGCHC 1 cut(s) 153
Bsp143I GATC 1 cut(s) 361
BspANI GGCC 1 cut(s) 99
BspTI CTTAAG 1 cut(s) 319
BspTNI GGTCTC 1 cut(s) 375
BsrDI GCAATG 1 cut(s) 57
BssECI CCNNGG 2 cut(s) 72, 111
BssMI GATC 1 cut(s) 361
BssNAI GTATAC 1 cut(s) 173
BssNI GRCGYC 1 cut(s) 77
Bst1107I GTATAC 1 cut(s) 173
Bst2UI CCWGG 1 cut(s) 96
Bst4CI ACNGT 1 cut(s) 235
BstACI GRCGYC 1 cut(s) 77
BstAFI CTTAAG 1 cut(s) 319
BstBAI YACGTR 1 cut(s) 170
BstDSI CCRYGG 1 cut(s) 72
BstKTI GATC 1 cut(s) 364
BstMAI GTCTC 2 cut(s) 84, 375
BstMBI GATC 1 cut(s) 361
BstNI CCWGG 1 cut(s) 96
BstSCI CCNGG 1 cut(s) 94
BstZ17I GTATAC 1 cut(s) 173
BsuRI GGCC 1 cut(s) 99
BtgI CCRYGG 1 cut(s) 72
CseI GACGC 1 cut(s) 66
Csp6I GTAC 2 cut(s) 51, 202
CviJI RGCY 3 cut(s) 99, 151, 327
CviKI_1 RGCY 3 cut(s) 99, 151, 327
CviQI GTAC 2 cut(s) 51, 202
DpnI GATC 1 cut(s) 363
DpnII GATC 1 cut(s) 361
Ecl136II GAGCTC 1 cut(s) 151
Eco24I GRGCYC 1 cut(s) 153
Eco31I GGTCTC 1 cut(s) 375
Eco53kI GAGCTC 1 cut(s) 151
Eco57I CTGAAG 1 cut(s) 145
EcoICRI GAGCTC 1 cut(s) 151
EcoRII CCWGG 1 cut(s) 94
EcoT38I GRGCYC 1 cut(s) 153
Esp3I CGTCTC 1 cut(s) 84
FaiI YATR 5 cut(s) 27, 46, 173, 191, 345
FblI GTMKAC 2 cut(s) 172, 349
FriOI GRGCYC 1 cut(s) 153
FspBI CTAG 1 cut(s) 380
GsuI CTGGAG 1 cut(s) 78
HaeIII GGCC 1 cut(s) 99
HgaI GACGC 1 cut(s) 66
Hin1I GRCGYC 1 cut(s) 77
HincII GTYRAC 1 cut(s) 350
HindII GTYRAC 1 cut(s) 350
HphI GGTGA 1 cut(s) 118
Hpy166II GTNNAC 3 cut(s) 173, 204, 350
Hpy188I TCNGA 2 cut(s) 112, 164
Hpy188III TCNNGA 1 cut(s) 359
Hpy8I GTNNAC 3 cut(s) 173, 204, 350
HpyAV CCTTC 1 cut(s) 64
HpyCH4III ACNGT 1 cut(s) 235
HpyCH4IV ACGT 1 cut(s) 169
HpyCH4V TGCA 1 cut(s) 340
HpySE526I ACGT 1 cut(s) 169
Hsp92I GRCGYC 1 cut(s) 77
Kzo9I GATC 1 cut(s) 361
LpnPI CCDG 3 cut(s) 81, 108, 276
MaeI CTAG 1 cut(s) 380
MaeII ACGT 1 cut(s) 169
MalI GATC 1 cut(s) 363
MboI GATC 1 cut(s) 361
MboII GAAGA 1 cut(s) 151
MhlI GDGCHC 1 cut(s) 153
MluCI AATT 3 cut(s) 12, 354, 375
MnlI CCTC 4 cut(s) 106, 139, 186, 339
MseI TTAA 2 cut(s) 228, 320
MspCI CTTAAG 1 cut(s) 319
MspR9I CCNGG 1 cut(s) 96
MvaI CCWGG 1 cut(s) 96
NdeII GATC 1 cut(s) 361
Ppu21I YACGTR 1 cut(s) 170
Psp124BI GAGCTC 1 cut(s) 153
Psp6I CCWGG 1 cut(s) 94
PspGI CCWGG 1 cut(s) 94
RsaI GTAC 2 cut(s) 52, 203
RsaNI GTAC 2 cut(s) 51, 202
SacI GAGCTC 1 cut(s) 153
SalI GTCGAC 1 cut(s) 348
SaqAI TTAA 2 cut(s) 228, 320
Sau3AI GATC 1 cut(s) 361
ScrFI CCNGG 1 cut(s) 96
SduI GDGCHC 1 cut(s) 153
SetI ASST 8 cut(s) 56, 131, 153, 172, 178, 265, 320, 371
SmlI CTYRAG 1 cut(s) 319
SmoI CTYRAG 1 cut(s) 319
Sse9I AATT 3 cut(s) 12, 354, 375
SspMI CTAG 1 cut(s) 380
SstI GAGCTC 1 cut(s) 153
StyD4I CCNGG 1 cut(s) 94
TaaI ACNGT 1 cut(s) 235
TaiI ACGT 1 cut(s) 172
TaqI TCGA 1 cut(s) 349
TasI AATT 3 cut(s) 12, 354, 375
Tru1I TTAA 2 cut(s) 228, 320
Tru9I TTAA 2 cut(s) 228, 320
TspDTI ATGAA 1 cut(s) 46
Vha464I CTTAAG 1 cut(s) 319
XapI RAATTY 1 cut(s) 12
XmiI GTMKAC 2 cut(s) 172, 349
XspI CTAG 1 cut(s) 380
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.