MD01G1130100.v1.1
HSP70 Family

ATP binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr01
OG0024377
Physical Location & Seq
Forward (+)
24062541 .. 24063029
489 bp
Loading structure...
UTR
Exon/CDS
Intron
MD01G1130100.v1.1.491

Sequence Viewer

Length: 489 bp
ATGCATGTGAGAAGGCAAAGAGGAGACTTTGATATATGCTTGAGACTGACATTGACATTGTTGGAGGGGAAGGAGCTGTGCAAGGGCATTTATCCAGATGAAGCTGTGGCATATGGTTCAGCTGTTCAAGCTGCCATGTTGAGTGAGAATAATGAAAATGGGAAGCTTCAAGACTTTGCACTCTTGGATGTCATCCCTCTATTACTTGGGGTGGAGACAACTCAGACAAGGTGGGAAAGTGGTTCTAACGATAAACATTTCATGCTAGTTGTGATCCCAAGAAACACCAGAGTTCCGATAAAAGAGAACGTTACTTTGTTTACTTCGGTTGACAACCAAGCTGTGGCCAGATTTTCAATTTATGAGGGCGAGAGTTCATCAACCTTAATACCTTTTTGGGTGGATTTCACATCCATGACATTCCTCCTGCTCCTGCCAGAGCTGCTAAATTCAAACTTTGCTTTGATATTGATGAAAATGGTATCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HSP70

Protein Analysis

163

Amino Acids

18.24

Weight (kDa)

5.01

Isoelectric Point (pI)

28.61

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HSP70 PF00012 21 - 126 3.1e-16 Hsp70 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024377)

Species Orthologous Gene IDs
malus_domestica MD01G1128600.v1.1 MD01G1130100.v1.1
pyrus_communis pycom01g15260

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 343
AclI AACGTT 1 cut(s) 309
AclWI GGATC 1 cut(s) 268
AcoI YGGCCR 1 cut(s) 345
AcsI RAATTY 1 cut(s) 448
AfiI CCNNNNNNNGG 1 cut(s) 343
AgsI TTSAA 4 cut(s) 128, 170, 357, 453
AluBI AGCT 7 cut(s) 76, 104, 122, 131, 166, 341, 442
AluI AGCT 7 cut(s) 76, 104, 122, 131, 166, 341, 442
Alw26I GTCTC 3 cut(s) 18, 37, 209
AlwI GGATC 1 cut(s) 268
AoxI GGCC 1 cut(s) 345
ApeKI GCWGC 2 cut(s) 131, 442
ApoI RAATTY 1 cut(s) 448
BalI TGGCCA 1 cut(s) 347
BbvI GCAGC 2 cut(s) 118, 429
BcoDI GTCTC 3 cut(s) 18, 37, 209
BfaI CTAG 1 cut(s) 266
BisI GCNGC 2 cut(s) 132, 443
BlsI GCNGC 2 cut(s) 133, 444
BpuEI CTTGAG 1 cut(s) 61
Bsc4I CCNNNNNNNGG 1 cut(s) 343
BseGI GGATG 3 cut(s) 192, 193, 410
BseLI CCNNNNNNNGG 1 cut(s) 343
BseMII CTCAG 1 cut(s) 236
BseRI GAGGAG 1 cut(s) 36
BseXI GCAGC 2 cut(s) 118, 429
BshFI GGCC 1 cut(s) 347
BslI CCNNNNNNNGG 1 cut(s) 343
BsmAI GTCTC 3 cut(s) 18, 37, 209
BsnI GGCC 1 cut(s) 347
Bsp143I GATC 1 cut(s) 273
BspANI GGCC 1 cut(s) 347
BspCNI CTCAG 1 cut(s) 235
BspPI GGATC 1 cut(s) 268
BssMI GATC 1 cut(s) 273
BstDEI CTNAG 1 cut(s) 222
BstF5I GGATG 3 cut(s) 192, 193, 410
BstKTI GATC 1 cut(s) 276
BstMAI GTCTC 3 cut(s) 18, 37, 209
BstMBI GATC 1 cut(s) 273
BstMWI GCNNNNNNNGC 2 cut(s) 128, 442
BstNSI RCATGY 1 cut(s) 8
BstV1I GCAGC 2 cut(s) 118, 429
BsuRI GGCC 1 cut(s) 347
BtsCI GGATG 3 cut(s) 192, 193, 410
CviAII CATG 4 cut(s) 5, 136, 262, 415
CviJI RGCY 8 cut(s) 76, 104, 122, 131, 166, 341, 347, 442
CviKI_1 RGCY 8 cut(s) 76, 104, 122, 131, 166, 341, 347, 442
DdeI CTNAG 1 cut(s) 222
DpnI GATC 1 cut(s) 275
DpnII GATC 1 cut(s) 273
EaeI YGGCCR 1 cut(s) 345
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 4 cut(s) 8, 139, 265, 418
FaiI YATR 9 cut(s) 6, 35, 37, 112, 114, 137, 263, 363, 416
FatI CATG 4 cut(s) 4, 135, 261, 414
FauNDI CATATG 1 cut(s) 112
Fnu4HI GCNGC 2 cut(s) 132, 443
FokI GGATG 3 cut(s) 179, 200, 397
Fsp4HI GCNGC 2 cut(s) 132, 443
FspBI CTAG 1 cut(s) 266
GluI GCNGC 2 cut(s) 132, 443
HaeIII GGCC 1 cut(s) 347
Hin1II CATG 4 cut(s) 8, 139, 265, 418
HincII GTYRAC 1 cut(s) 331
HindII GTYRAC 1 cut(s) 331
HindIII AAGCTT 1 cut(s) 164
Hpy166II GTNNAC 2 cut(s) 321, 331
Hpy188I TCNGA 2 cut(s) 225, 297
Hpy188III TCNNGA 3 cut(s) 95, 170, 486
Hpy8I GTNNAC 2 cut(s) 321, 331
HpyAV CCTTC 2 cut(s) 6, 64
HpyCH4IV ACGT 1 cut(s) 309
HpyCH4V TGCA 3 cut(s) 4, 81, 179
HpyF10VI GCNNNNNNNGC 2 cut(s) 128, 442
HpyF3I CTNAG 1 cut(s) 222
HpySE526I ACGT 1 cut(s) 309
Hsp92II CATG 4 cut(s) 8, 139, 265, 418
Kzo9I GATC 1 cut(s) 273
LmnI GCTCC 2 cut(s) 73, 435
LpnPI CCDG 6 cut(s) 108, 301, 361, 440, 446, 450
Lsp1109I GCAGC 2 cut(s) 118, 429
MaeI CTAG 1 cut(s) 266
MaeII ACGT 1 cut(s) 309
MaeIII GTNAC 1 cut(s) 310
MalI GATC 1 cut(s) 275
MboI GATC 1 cut(s) 273
MlsI TGGCCA 1 cut(s) 347
MluCI AATT 2 cut(s) 357, 448
MluNI TGGCCA 1 cut(s) 347
MmeI TCCRAC 1 cut(s) 42
MnlI CCTC 5 cut(s) 14, 58, 207, 358, 434
Mox20I TGGCCA 1 cut(s) 347
Mph1103I ATGCAT 1 cut(s) 6
MscI TGGCCA 1 cut(s) 347
MseI TTAA 1 cut(s) 386
MslI CAYNNNNRTG 1 cut(s) 413
Msp20I TGGCCA 1 cut(s) 347
MspA1I CMGCKG 1 cut(s) 122
MwoI GCNNNNNNNGC 2 cut(s) 128, 442
NdeI CATATG 1 cut(s) 112
NdeII GATC 1 cut(s) 273
NlaIII CATG 4 cut(s) 8, 139, 265, 418
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 8
PflMI CCANNNNNTGG 1 cut(s) 343
PkrI GCNGC 2 cut(s) 133, 444
Psp1406I AACGTT 1 cut(s) 309
PvuII CAGCTG 1 cut(s) 122
RseI CAYNNNNRTG 1 cut(s) 413
SaqAI TTAA 1 cut(s) 386
SatI GCNGC 2 cut(s) 132, 443
Sau3AI GATC 1 cut(s) 273
SmiMI CAYNNNNRTG 1 cut(s) 413
SmlI CTYRAG 1 cut(s) 40
SmoI CTYRAG 1 cut(s) 40
Sse9I AATT 2 cut(s) 357, 448
SspMI CTAG 1 cut(s) 266
TaiI ACGT 1 cut(s) 312
TasI AATT 2 cut(s) 357, 448
Tru1I TTAA 1 cut(s) 386
Tru9I TTAA 1 cut(s) 386
TseI GCWGC 2 cut(s) 131, 442
TspDTI ATGAA 5 cut(s) 114, 168, 250, 366, 488
Van91I CCANNNNNTGG 1 cut(s) 343
XapI RAATTY 1 cut(s) 448
XceI RCATGY 1 cut(s) 8
XspI CTAG 1 cut(s) 266
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.