MD02G1295500.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
Physical Location & Seq
Reverse (-)
34999540 .. 35001964
2425 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1295500.v1.1.491

Sequence Viewer

Length: 189 bp
ATGACTGCTAGGGTATCAAGGAGGAACTGGGTTCAAGAATACAGCAGGACATGTGAAGCACCAAGCCGTGGCACTGCGTGTACAATCCGACTTCTCCATCTTCTTAAACTGTCACATGGACGCATACCAAGACACCCTCTACACACAACCTTCTCCTCTCTGCAAAACTCAATGCTCTCCAAGTTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.15

Weight (kDa)

11.55

Isoelectric Point (pI)

50.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0028583)

Species Orthologous Gene IDs
malus_domestica MD02G1295500.v1.1
pyrus_communis pycom15g02510

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 68
AdeI CACNNNGTG 1 cut(s) 78
AfaI GTAC 1 cut(s) 82
AfiI CCNNNNNNNGG 1 cut(s) 68
AflIII ACRYGT 1 cut(s) 50
AgsI TTSAA 1 cut(s) 35
BccI CCATC 1 cut(s) 105
BceAI ACGGC 1 cut(s) 51
BfaI CTAG 1 cut(s) 9
BmrI ACTGGG 1 cut(s) 37
BmuI ACTGGG 1 cut(s) 37
BsaJI CCNNGG 1 cut(s) 67
Bsc4I CCNNNNNNNGG 1 cut(s) 68
Bse1I ACTGG 1 cut(s) 32
BseDI CCNNGG 1 cut(s) 67
BseLI CCNNNNNNNGG 1 cut(s) 68
BseNI ACTGG 1 cut(s) 32
BseRI GAGGAG 1 cut(s) 145
BslI CCNNNNNNNGG 1 cut(s) 68
Bsp1407I TGTACA 1 cut(s) 80
BsrGI TGTACA 1 cut(s) 80
BsrI ACTGG 1 cut(s) 32
BssECI CCNNGG 1 cut(s) 67
Bst4CI ACNGT 1 cut(s) 111
BstAUI TGTACA 1 cut(s) 80
BstDSI CCRYGG 1 cut(s) 67
BstNSI RCATGY 1 cut(s) 54
BtgI CCRYGG 1 cut(s) 67
BtsI GCAGTG 1 cut(s) 72
BtsIMutI CAGTG 1 cut(s) 72
CseI GACGC 1 cut(s) 129
Csp6I GTAC 1 cut(s) 81
CviAII CATG 2 cut(s) 51, 116
CviJI RGCY 1 cut(s) 66
CviKI_1 RGCY 1 cut(s) 66
CviQI GTAC 1 cut(s) 81
DraIII CACNNNGTG 1 cut(s) 78
FaeI CATG 2 cut(s) 54, 119
FaiI YATR 4 cut(s) 52, 117, 125, 187
FatI CATG 2 cut(s) 50, 115
FspBI CTAG 1 cut(s) 9
HgaI GACGC 1 cut(s) 129
Hin1II CATG 2 cut(s) 54, 119
Hpy166II GTNNAC 1 cut(s) 81
Hpy188I TCNGA 1 cut(s) 89
Hpy188III TCNNGA 1 cut(s) 35
Hpy8I GTNNAC 1 cut(s) 81
HpyAV CCTTC 1 cut(s) 160
HpyCH4III ACNGT 1 cut(s) 111
HpyCH4V TGCA 1 cut(s) 163
Hsp92II CATG 2 cut(s) 54, 119
LpnPI CCDG 2 cut(s) 13, 31
MaeI CTAG 1 cut(s) 9
MaeIII GTNAC 1 cut(s) 111
MboII GAAGA 1 cut(s) 92
MmeI TCCRAC 1 cut(s) 112
MnlI CCTC 3 cut(s) 15, 147, 166
MseI TTAA 1 cut(s) 105
NlaIII CATG 2 cut(s) 54, 119
NmuCI GTSAC 1 cut(s) 111
NspI RCATGY 1 cut(s) 54
PciI ACATGT 1 cut(s) 50
PflMI CCANNNNNTGG 1 cut(s) 68
PscI ACATGT 1 cut(s) 50
RsaI GTAC 1 cut(s) 82
RsaNI GTAC 1 cut(s) 81
SaqAI TTAA 1 cut(s) 105
SetI ASST 1 cut(s) 152
SspMI CTAG 1 cut(s) 9
TaaI ACNGT 1 cut(s) 111
TatI WGTACW 1 cut(s) 80
Tru1I TTAA 1 cut(s) 105
Tru9I TTAA 1 cut(s) 105
TscAI CASTG 1 cut(s) 79
TseFI GTSAC 1 cut(s) 111
Tsp45I GTSAC 1 cut(s) 111
TspRI CASTG 1 cut(s) 79
Van91I CCANNNNNTGG 1 cut(s) 68
XceI RCATGY 1 cut(s) 54
XspI CTAG 1 cut(s) 9
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.