MD03G1121500.v1.1

Belongs to the PAL histidase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
OG0028491
Physical Location & Seq
Forward (+)
11302894 .. 11304058
1165 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1121500.v1.1.491

Sequence Viewer

Length: 345 bp
ATGGCCTCAAACTATTTGGTTGCACTTTGCCAGGCTATAGACTTGAGGCATTTGGAAAAGAATATGAGGAACAGCGTTAAGCTTGCAGTTAGCAACGTTGCGAAAAGGGTTCTAATGGTCGAAGGCGTTGGGGATCTCCATCCGTCAAGGTTTTGTGAGAAAGATTTGCTCAAAGTAATCAACGATGAACCTGTTTTTGCTTACATCGACGATCCGTGCGGTGAACATTCTGTCATTGTACAGAAACTGAAGCTAGTCTTGGTCAATCATGCACTGGCAAACAACGATGACATGACGAACCCAAGTGCTTCAATTTTTCTGAAGATTGGTGCATTTGAGCGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00360 ko00940 ko01100 ko01110 map00360 map00940 map01100 map01110
Pfam Domains
Protein Families
Lyase_aromatic

Protein Analysis

115

Amino Acids

12.69

Weight (kDa)

6.4

Isoelectric Point (pI)

12.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0028491)

Species Orthologous Gene IDs
malus_domestica MD03G1121500.v1.1
prunus_persica Prupe.6G104500_v2.0.a1

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 219
AclI AACGTT 1 cut(s) 96
AclWI GGATC 2 cut(s) 141, 206
AcuI CTGAAG 2 cut(s) 269, 341
AfaI GTAC 1 cut(s) 240
AgsI TTSAA 1 cut(s) 312
AjnI CCWGG 1 cut(s) 30
AjuI GAANNNNNNNTTGG 2 cut(s) 242, 274
AluBI AGCT 2 cut(s) 82, 253
AluI AGCT 2 cut(s) 82, 253
AlwI GGATC 2 cut(s) 141, 206
AlwNI CAGNNNCTG 1 cut(s) 247
AoxI GGCC 1 cut(s) 3
AsuHPI GGTGA 1 cut(s) 233
BccI CCATC 1 cut(s) 147
BciT130I CCWGG 1 cut(s) 32
BfaI CTAG 1 cut(s) 254
BfmI CTRYAG 1 cut(s) 36
Bme1390I CCNGG 1 cut(s) 32
BmrFI CCNGG 1 cut(s) 32
BpuEI CTTGAG 1 cut(s) 64
BsaBI GATNNNNATC 1 cut(s) 138
Bse1I ACTGG 1 cut(s) 279
Bse8I GATNNNNATC 1 cut(s) 138
BseBI CCWGG 1 cut(s) 32
BseGI GGATG 1 cut(s) 139
BseJI GATNNNNATC 1 cut(s) 138
BseNI ACTGG 1 cut(s) 279
BshFI GGCC 1 cut(s) 5
BsnI GGCC 1 cut(s) 5
Bsp1407I TGTACA 1 cut(s) 238
Bsp143I GATC 2 cut(s) 133, 211
BspACI CCGC 1 cut(s) 219
BspANI GGCC 1 cut(s) 5
BspPI GGATC 2 cut(s) 141, 206
BsrGI TGTACA 1 cut(s) 238
BsrI ACTGG 1 cut(s) 279
BssMI GATC 2 cut(s) 133, 211
Bst2UI CCWGG 1 cut(s) 32
BstAUI TGTACA 1 cut(s) 238
BstC8I GCNNGC 1 cut(s) 84
BstF5I GGATG 1 cut(s) 139
BstKTI GATC 2 cut(s) 136, 214
BstMBI GATC 2 cut(s) 133, 211
BstNI CCWGG 1 cut(s) 32
BstSCI CCNGG 1 cut(s) 30
BstSFI CTRYAG 1 cut(s) 36
BstX2I RGATCY 1 cut(s) 133
BstYI RGATCY 1 cut(s) 133
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 139
BtsIMutI CAGTG 1 cut(s) 272
Cac8I GCNNGC 1 cut(s) 84
CaiI CAGNNNCTG 1 cut(s) 247
Csp6I GTAC 1 cut(s) 239
CviAII CATG 2 cut(s) 269, 292
CviJI RGCY 4 cut(s) 5, 35, 82, 253
CviKI_1 RGCY 4 cut(s) 5, 35, 82, 253
CviQI GTAC 1 cut(s) 239
DpnI GATC 2 cut(s) 135, 213
DpnII GATC 2 cut(s) 133, 211
Eco57I CTGAAG 2 cut(s) 269, 341
EcoRII CCWGG 1 cut(s) 30
FaeI CATG 2 cut(s) 272, 295
FaiI YATR 4 cut(s) 38, 65, 270, 293
FalI AAGNNNNNCTT 2 cut(s) 242, 274
FatI CATG 2 cut(s) 268, 291
FokI GGATG 1 cut(s) 126
FspBI CTAG 1 cut(s) 254
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 2 cut(s) 272, 295
HindIII AAGCTT 1 cut(s) 80
HphI GGTGA 1 cut(s) 233
Hpy166II GTNNAC 1 cut(s) 224
Hpy188I TCNGA 1 cut(s) 321
Hpy8I GTNNAC 1 cut(s) 224
Hpy99I CGWCG 1 cut(s) 212
HpyAV CCTTC 1 cut(s) 116
HpyCH4IV ACGT 1 cut(s) 96
HpyCH4V TGCA 4 cut(s) 23, 86, 272, 332
HpySE526I ACGT 1 cut(s) 96
Hsp92II CATG 2 cut(s) 272, 295
Kzo9I GATC 2 cut(s) 133, 211
LpnPI CCDG 4 cut(s) 17, 44, 204, 260
MaeI CTAG 1 cut(s) 254
MaeII ACGT 1 cut(s) 96
MalI GATC 2 cut(s) 135, 213
MboI GATC 2 cut(s) 133, 211
MboII GAAGA 1 cut(s) 334
MflI RGATCY 1 cut(s) 133
MluCI AATT 1 cut(s) 312
MnlI CCTC 3 cut(s) 16, 39, 60
MseI TTAA 1 cut(s) 78
MspR9I CCNGG 1 cut(s) 32
MvaI CCWGG 1 cut(s) 32
NdeII GATC 2 cut(s) 133, 211
NlaIII CATG 2 cut(s) 272, 295
Psp1406I AACGTT 1 cut(s) 96
Psp6I CCWGG 1 cut(s) 30
PspGI CCWGG 1 cut(s) 30
PstNI CAGNNNCTG 1 cut(s) 247
PsuI RGATCY 1 cut(s) 133
RsaI GTAC 1 cut(s) 240
RsaNI GTAC 1 cut(s) 239
SaqAI TTAA 1 cut(s) 78
Sau3AI GATC 2 cut(s) 133, 211
ScrFI CCNGG 1 cut(s) 32
SetI ASST 5 cut(s) 84, 99, 152, 193, 255
SfcI CTRYAG 1 cut(s) 36
SmlI CTYRAG 1 cut(s) 43
SmoI CTYRAG 1 cut(s) 43
Sse9I AATT 1 cut(s) 312
SsiI CCGC 1 cut(s) 219
SspMI CTAG 1 cut(s) 254
StyD4I CCNGG 1 cut(s) 30
TaiI ACGT 1 cut(s) 99
TaqI TCGA 2 cut(s) 120, 207
TasI AATT 1 cut(s) 312
TatI WGTACW 1 cut(s) 238
Tru1I TTAA 1 cut(s) 78
Tru9I TTAA 1 cut(s) 78
TscAI CASTG 1 cut(s) 279
TspDTI ATGAA 1 cut(s) 201
TspGWI ACGGA 2 cut(s) 132, 204
TspRI CASTG 1 cut(s) 279
XspI CTAG 1 cut(s) 254
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.