MD03G1248400.v1.1

DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
OG0028484
Physical Location & Seq
Forward (+)
33565478 .. 33566711
1234 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1248400.v1.1.491

Sequence Viewer

Length: 138 bp
ATGGAGAATTATTCTCCATTCTTCCTCCCTGTGCTTCACCTAATTGGCACTAGGCGTTCCACCCCGTATGCCAACAAACAGATTCAAGAACTATTGGGAGTGTCTTGTGCTTTTGGTCAAGCAGTTCAGGTGTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0000419 GO:0000428 GO:0003674 GO:0003824 GO:0003899 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005666 GO:0005730 GO:0006139 GO:0006259 GO:0006304 GO:0006305 GO:0006306 GO:0006396 GO:0006725 GO:0006807 GO:0006950 GO:0006952 GO:0008150 GO:0008152 GO:0009058 GO:0009059 GO:0009605 GO:0009607 GO:0009620 GO:0009892 GO:0009987 GO:0010033 GO:0010467 GO:0010468 GO:0010605 GO:0010608 GO:0010629 GO:0014070 GO:0016070 GO:0016246 GO:0016441 GO:0016458 GO:0016604 GO:0016740 GO:0016772 GO:0016779 GO:0018130 GO:0019222 GO:0019438 GO:0030422 GO:0030880 GO:0031047 GO:0031050 GO:0031974 GO:0031981 GO:0032259 GO:0032774 GO:0032991 GO:0034062 GO:0034641 GO:0034654 GO:0035194 GO:0040029 GO:0042221 GO:0043170 GO:0043207 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0043331 GO:0043412 GO:0043414 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044271 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044451 GO:0044464 GO:0044728 GO:0046483 GO:0048519 GO:0050789 GO:0050832 GO:0050896 GO:0051704 GO:0051707 GO:0051716 GO:0055029 GO:0060255 GO:0061695 GO:0065007 GO:0070013 GO:0070887 GO:0070918 GO:0071310 GO:0071359 GO:0071407 GO:0071704 GO:0090304 GO:0097747 GO:0098542 GO:0140098 GO:1901360 GO:1901362 GO:1901576 GO:1901698 GO:1901699 GO:1902494 GO:1990234
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF3223 RNA_pol_Rpb1_1 RNA_pol_Rpb1_2 RNA_pol_Rpb1_3 RNA_pol_Rpb1_5

Protein Analysis

46

Amino Acids

5.07

Weight (kDa)

7.96

Isoelectric Point (pI)

78.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0028484)

Species Orthologous Gene IDs
malus_domestica MD03G1248400.v1.1
pyrus_communis pycom03g19770

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 86
AsuHPI GGTGA 1 cut(s) 29
BfaI CTAG 1 cut(s) 51
FaiI YATR 1 cut(s) 69
FspBI CTAG 1 cut(s) 51
HinfI GANTC 1 cut(s) 82
HphI GGTGA 1 cut(s) 29
Hpy188I TCNGA 1 cut(s) 137
Hpy188III TCNNGA 1 cut(s) 86
LpnPI CCDG 2 cut(s) 42, 113
MaeI CTAG 1 cut(s) 51
MboII GAAGA 1 cut(s) 13
MluCI AATT 2 cut(s) 7, 42
MnlI CCTC 1 cut(s) 35
PfeI GAWTC 1 cut(s) 82
SetI ASST 2 cut(s) 42, 132
SgeI CNNG 6 cut(s) 41, 63, 76, 98, 117, 131
Sse9I AATT 2 cut(s) 7, 42
SspMI CTAG 1 cut(s) 51
TasI AATT 2 cut(s) 7, 42
TfiI GAWTC 1 cut(s) 82
XspI CTAG 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.