MD04G1096300.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
OG0019774
Physical Location & Seq
Reverse (-)
17759526 .. 17760298
773 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1096300.v1.1.491

Sequence Viewer

Length: 168 bp
ATGGGATTTGTAGTTGTGATTTCAGCGCCGGTGATACTGTTAATATTGGTTTTAGCTCTTGCTTTTTACCTCCTTGGAAGGGCATCTGGCCGAAGGGAATCACCTTCTGCTCCACAATATTTTGGACCTCCGGTCCCTCCAACCCAAGAGAAGTCCGCCAAGGTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

5.85

Weight (kDa)

9.99

Isoelectric Point (pI)

75.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019774)

Species Orthologous Gene IDs
malus_domestica MD04G1096300.v1.1 MD12G1117300.v1.1
prunus_persica Prupe.6G235500_v2.0.a1 Prupe.6G235500_v2.0.a1
rosa_chinensis RchiOBHm_Chr3g0469801
rosa_roxburghii Rroxscaffold_6G00411460
rosa_wichuraiana Rw3G014490

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 156
AcoI YGGCCR 1 cut(s) 88
AfiI CCNNNNNNNGG 1 cut(s) 79
AhdI GACNNNNNGTC 1 cut(s) 131
AluBI AGCT 1 cut(s) 56
AluI AGCT 1 cut(s) 56
AoxI GGCC 1 cut(s) 88
AspLEI GCGC 1 cut(s) 28
AspS9I GGNCC 2 cut(s) 125, 133
AsuHPI GGTGA 2 cut(s) 43, 93
AvaII GGWCC 2 cut(s) 125, 133
BfaI CTAG 1 cut(s) 166
BfoI RGCGCY 1 cut(s) 29
Bme18I GGWCC 2 cut(s) 125, 133
BmeRI GACNNNNNGTC 1 cut(s) 131
BmgT120I GGNCC 2 cut(s) 125, 133
BmiI GGNNCC 1 cut(s) 135
BmsI GCATC 1 cut(s) 92
BsaJI CCNNGG 2 cut(s) 73, 159
BsaWI WCCGGW 1 cut(s) 130
Bsc4I CCNNNNNNNGG 1 cut(s) 79
Bse118I RCCGGY 1 cut(s) 28
BseDI CCNNGG 2 cut(s) 73, 159
BseLI CCNNNNNNNGG 1 cut(s) 79
BshFI GGCC 1 cut(s) 90
BsiSI CCGG 2 cut(s) 29, 131
BslFI GGGAC 1 cut(s) 119
BslI CCNNNNNNNGG 1 cut(s) 79
BsmFI GGGAC 1 cut(s) 119
BsnI GGCC 1 cut(s) 90
BspACI CCGC 1 cut(s) 156
BspANI GGCC 1 cut(s) 90
BspLI GGNNCC 1 cut(s) 135
BsrFI RCCGGY 1 cut(s) 28
BssAI RCCGGY 1 cut(s) 28
BssECI CCNNGG 2 cut(s) 73, 159
BssT1I CCWWGG 2 cut(s) 73, 159
Bst4CI ACNGT 1 cut(s) 39
BstH2I RGCGCY 1 cut(s) 29
BstHHI GCGC 1 cut(s) 28
BsuRI GGCC 1 cut(s) 90
CfoI GCGC 1 cut(s) 28
Cfr10I RCCGGY 1 cut(s) 28
Cfr13I GGNCC 2 cut(s) 125, 133
CviJI RGCY 2 cut(s) 56, 90
CviKI_1 RGCY 2 cut(s) 56, 90
DriI GACNNNNNGTC 1 cut(s) 131
EaeI YGGCCR 1 cut(s) 88
Eam1105I GACNNNNNGTC 1 cut(s) 131
EciI GGCGGA 1 cut(s) 145
Eco130I CCWWGG 2 cut(s) 73, 159
Eco47I GGWCC 2 cut(s) 125, 133
EcoT14I CCWWGG 2 cut(s) 73, 159
ErhI CCWWGG 2 cut(s) 73, 159
FaqI GGGAC 1 cut(s) 119
FspBI CTAG 1 cut(s) 166
GlaI GCGC 1 cut(s) 27
HaeII RGCGCY 1 cut(s) 29
HaeIII GGCC 1 cut(s) 90
HapII CCGG 2 cut(s) 29, 131
HhaI GCGC 1 cut(s) 28
Hin6I GCGC 1 cut(s) 26
HinP1I GCGC 1 cut(s) 26
HinfI GANTC 1 cut(s) 98
HpaII CCGG 2 cut(s) 29, 131
HphI GGTGA 2 cut(s) 43, 93
HpyAV CCTTC 3 cut(s) 72, 87, 114
HpyCH4III ACNGT 1 cut(s) 39
HspAI GCGC 1 cut(s) 26
LmnI GCTCC 1 cut(s) 115
LpnPI CCDG 3 cut(s) 42, 72, 144
LweI GCATC 1 cut(s) 92
MaeI CTAG 1 cut(s) 166
MmeI TCCRAC 1 cut(s) 164
MnlI CCTC 3 cut(s) 80, 138, 147
MseI TTAA 1 cut(s) 41
MspI CCGG 2 cut(s) 29, 131
NlaIV GGNNCC 1 cut(s) 135
PfeI GAWTC 1 cut(s) 98
PspN4I GGNNCC 1 cut(s) 135
PspPI GGNCC 2 cut(s) 125, 133
SaqAI TTAA 1 cut(s) 41
Sau96I GGNCC 2 cut(s) 125, 133
SetI ASST 5 cut(s) 58, 72, 106, 130, 165
SfaNI GCATC 1 cut(s) 92
SgeI CNNG 6 cut(s) 41, 71, 86, 99, 143, 158
SgrAI CRCCGGYG 1 cut(s) 28
SinI GGWCC 2 cut(s) 125, 133
SsiI CCGC 1 cut(s) 156
SspI AATATT 2 cut(s) 45, 119
SspMI CTAG 1 cut(s) 166
StyI CCWWGG 2 cut(s) 73, 159
TaaI ACNGT 1 cut(s) 39
TfiI GAWTC 1 cut(s) 98
Tru1I TTAA 1 cut(s) 41
Tru9I TTAA 1 cut(s) 41
VpaK11BI GGWCC 2 cut(s) 125, 133
XspI CTAG 1 cut(s) 166
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.