Prupe.6G235500_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Reverse (-)
23651217 .. 23652105
889 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G235500.2

Sequence Viewer

Length: 177 bp
ATGGGATATGTTGTGGTGGTATCAGTTCCTGTGATATTGTTCATCGTGATTGTAGCCCTTGCTTTTTACCTCATTGGTAGGGCAAACGGCCGAAGGGAAGCTGTCTCTGCTCAACAGCATTTTGGGCCTCCAGTGCCTCCTCCACTACAGGCCCAGGAAAAGTCCGACCAGGTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.27

Weight (kDa)

8.27

Isoelectric Point (pI)

54.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019774)

Species Orthologous Gene IDs
malus_domestica MD04G1096300.v1.1 MD12G1117300.v1.1
prunus_persica Prupe.6G235500_v2.0.a1 Prupe.6G235500_v2.0.a1
rosa_chinensis RchiOBHm_Chr3g0469801
rosa_roxburghii Rroxscaffold_6G00411460
rosa_wichuraiana Rw3G014490

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 88
AjnI CCWGG 2 cut(s) 153, 168
AluBI AGCT 1 cut(s) 101
AluI AGCT 1 cut(s) 101
Alw26I GTCTC 1 cut(s) 109
AlwNI CAGNNNCTG 1 cut(s) 29
AoxI GGCC 3 cut(s) 88, 125, 150
AspS9I GGNCC 2 cut(s) 125, 151
BceAI ACGGC 1 cut(s) 103
BciT130I CCWGG 2 cut(s) 155, 170
BcoDI GTCTC 1 cut(s) 109
BfmI CTRYAG 1 cut(s) 146
Bme1390I CCNGG 2 cut(s) 155, 170
BmgT120I GGNCC 2 cut(s) 125, 151
BmrFI CCNGG 2 cut(s) 155, 170
BpmI CTGGAG 1 cut(s) 114
BsaJI CCNNGG 1 cut(s) 153
Bse1I ACTGG 1 cut(s) 131
BseBI CCWGG 2 cut(s) 155, 170
BseDI CCNNGG 1 cut(s) 153
BseNI ACTGG 1 cut(s) 131
BseRI GAGGAG 1 cut(s) 129
BseX3I CGGCCG 1 cut(s) 88
Bsh1285I CGRYCG 1 cut(s) 91
BshFI GGCC 3 cut(s) 90, 127, 152
BsiEI CGRYCG 1 cut(s) 91
BsmAI GTCTC 1 cut(s) 109
BsnI GGCC 3 cut(s) 90, 127, 152
BspANI GGCC 3 cut(s) 90, 127, 152
BsrI ACTGG 1 cut(s) 131
BssECI CCNNGG 1 cut(s) 153
Bst2UI CCWGG 2 cut(s) 155, 170
BstMAI GTCTC 1 cut(s) 109
BstMCI CGRYCG 1 cut(s) 91
BstMWI GCNNNNNNNGC 3 cut(s) 107, 124, 133
BstNI CCWGG 2 cut(s) 155, 170
BstSCI CCNGG 2 cut(s) 153, 168
BstSFI CTRYAG 1 cut(s) 146
BstZI CGGCCG 1 cut(s) 88
BsuRI GGCC 3 cut(s) 90, 127, 152
BtsIMutI CAGTG 1 cut(s) 138
CaiI CAGNNNCTG 1 cut(s) 29
Cfr13I GGNCC 2 cut(s) 125, 151
CsiI ACCWGGT 1 cut(s) 168
CviJI RGCY 5 cut(s) 56, 90, 101, 127, 152
CviKI_1 RGCY 5 cut(s) 56, 90, 101, 127, 152
EaeI YGGCCR 1 cut(s) 88
EagI CGGCCG 1 cut(s) 88
EclXI CGGCCG 1 cut(s) 88
Eco52I CGGCCG 1 cut(s) 88
EcoRII CCWGG 2 cut(s) 153, 168
FaiI YATR 1 cut(s) 9
GsuI CTGGAG 1 cut(s) 114
HaeIII GGCC 3 cut(s) 90, 127, 152
Hpy188I TCNGA 2 cut(s) 166, 176
Hpy188III TCNNGA 1 cut(s) 46
HpyAV CCTTC 1 cut(s) 87
HpyF10VI GCNNNNNNNGC 3 cut(s) 107, 124, 133
LpnPI CCDG 6 cut(s) 42, 134, 140, 144, 155, 167
MabI ACCWGGT 1 cut(s) 168
MnlI CCTC 4 cut(s) 80, 138, 147, 150
MspR9I CCNGG 2 cut(s) 155, 170
MvaI CCWGG 2 cut(s) 155, 170
MwoI GCNNNNNNNGC 3 cut(s) 107, 124, 133
PflFI GACNNNGTC 1 cut(s) 170
Psp6I CCWGG 2 cut(s) 153, 168
PspGI CCWGG 2 cut(s) 153, 168
PspPI GGNCC 2 cut(s) 125, 151
PstNI CAGNNNCTG 1 cut(s) 29
PsyI GACNNNGTC 1 cut(s) 170
Sau96I GGNCC 2 cut(s) 125, 151
ScrFI CCNGG 2 cut(s) 155, 170
SetI ASST 3 cut(s) 72, 103, 174
SexAI ACCWGGT 1 cut(s) 168
SfcI CTRYAG 1 cut(s) 146
SgeI CNNG 7 cut(s) 41, 58, 71, 143, 161, 166, 167
StyD4I CCNGG 2 cut(s) 153, 168
TscAI CASTG 1 cut(s) 138
TspDTI ATGAA 1 cut(s) 31
TspRI CASTG 1 cut(s) 138
Tth111I GACNNNGTC 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.