Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr07

Orthogroup ID

OG0021203

Physical Location & Seq

Genomic Coordinates Forward (+)

2624522 .. 2626506

Gene Structure 1985 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD07G1032400.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 180 bp

ATGAAGAAGATGGTGGTTCCTGATGCTATCAAGGTTTTGAGGCTTCAGAAGGGCCACAAATACAGCTTGTTGGGTCAGCTTTTGTCCGAGGTCGGATGGAATCATTATGACACCATCAAGGAGCTAGAGAACAAGAGAAAGGAGATGGCTGAGTTGGCATACGAGAGGAAGCTTGGTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003729 GO:0003735 GO:0005198 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0005840 GO:0005844 GO:0005911 GO:0006412 GO:0006518 GO:0006807 GO:0008150 GO:0008152 GO:0009058 GO:0009059 GO:0009506 GO:0009987 GO:0010467 GO:0015934 GO:0016020 GO:0019538 GO:0022625 GO:0022626 GO:0030054 GO:0032991 GO:0034641 GO:0034645 GO:0042788 GO:0043043 GO:0043170 GO:0043226 GO:0043228 GO:0043229 GO:0043232 GO:0043603 GO:0043604 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044267 GO:0044271 GO:0044391 GO:0044422 GO:0044424 GO:0044444 GO:0044445 GO:0044446 GO:0044464 GO:0055044 GO:0071704 GO:0097159 GO:1901363 GO:1901564 GO:1901566 GO:1901576 GO:1990904

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

Ribosomal_L13

Protein Analysis

60

Amino Acids

6.93

Weight (kDa)

9.52

Isoelectric Point (pI)

48.23

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021203)

Species	Orthologous Gene IDs
malus_domestica	MD07G1031400.v1.1 MD07G1032400.v1.1
rosa_multiflora	Rmu_co8431567.1_g000001 Rmu_sc0004076.1_g000024 Rmu_sc0040271.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	1 cut(s)	29
AluBI	AGCT	4 cut(s)	66, 79, 124, 172
AluI	AGCT	4 cut(s)	66, 79, 124, 172
AoxI	GGCC	1 cut(s)	52
AspS9I	GGNCC	1 cut(s)	52
BccI	CCATC	4 cut(s)	4, 90, 122, 139
BfaI	CTAG	1 cut(s)	125
BmgT120I	GGNCC	1 cut(s)	52
BmiI	GGNNCC	1 cut(s)	18
BmsI	GCATC	1 cut(s)	13
BsaJI	CCNNGG	1 cut(s)	87
BseDI	CCNNGG	1 cut(s)	87
BseGI	GGATG	1 cut(s)	101
BseMII	CTCAG	1 cut(s)	141
BshFI	GGCC	1 cut(s)	54
BsnI	GGCC	1 cut(s)	54
BspANI	GGCC	1 cut(s)	54
BspCNI	CTCAG	1 cut(s)	142
BspLI	GGNNCC	1 cut(s)	18
BssECI	CCNNGG	1 cut(s)	87
BstDEI	CTNAG	1 cut(s)	150
BstF5I	GGATG	1 cut(s)	101
BstMWI	GCNNNNNNNGC	1 cut(s)	155
BsuRI	GGCC	1 cut(s)	54
BtsCI	GGATG	1 cut(s)	101
Cfr13I	GGNCC	1 cut(s)	52
CviJI	RGCY	7 cut(s)	43, 54, 66, 79, 124, 149, 172
CviKI_1	RGCY	7 cut(s)	43, 54, 66, 79, 124, 149, 172
DdeI	CTNAG	1 cut(s)	150
Eco57I	CTGAAG	1 cut(s)	29
FaiI	YATR	2 cut(s)	108, 160
FokI	GGATG	1 cut(s)	108
FspBI	CTAG	1 cut(s)	125
HaeIII	GGCC	1 cut(s)	54
HindIII	AAGCTT	1 cut(s)	170
HinfI	GANTC	1 cut(s)	100
Hpy188I	TCNGA	3 cut(s)	48, 88, 95
Hpy188III	TCNNGA	1 cut(s)	20
HpyAV	CCTTC	1 cut(s)	43
HpyF10VI	GCNNNNNNNGC	1 cut(s)	155
HpyF3I	CTNAG	1 cut(s)	150
LmnI	GCTCC	1 cut(s)	121
LpnPI	CCDG	1 cut(s)	33
LweI	GCATC	1 cut(s)	13
MaeI	CTAG	1 cut(s)	125
MboII	GAAGA	2 cut(s)	16, 19
MmeI	TCCRAC	1 cut(s)	73
MnlI	CCTC	3 cut(s)	33, 82, 159
MwoI	GCNNNNNNNGC	1 cut(s)	155
NlaIV	GGNNCC	1 cut(s)	18
PfeI	GAWTC	1 cut(s)	100
PspN4I	GGNNCC	1 cut(s)	18
PspPI	GGNCC	1 cut(s)	52
Sau96I	GGNCC	1 cut(s)	52
SetI	ASST	6 cut(s)	36, 68, 81, 93, 126, 174
SfaNI	GCATC	1 cut(s)	13
SgeI	CNNG	8 cut(s)	32, 43, 79, 100, 130, 137, 145, 175
SspMI	CTAG	1 cut(s)	125
TfiI	GAWTC	1 cut(s)	100
TspDTI	ATGAA	1 cut(s)	17
XspI	CTAG	1 cut(s)	125

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.