MD09G1108700.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
OG0010136
Physical Location & Seq
Forward (+)
8046564 .. 8047001
438 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1108700.v1.1.491

Sequence Viewer

Length: 438 bp
ATGGGAAATTGTTTGAGAAATAATAACAAGATTGCATCACAAGATTATGAGAAGCATGAAGCAGCAAAGGAAGCAGAACCCCCAGAAGCCAGAAAAACAGCAATGCCATTGCCGTCGAATTTGAAGCAGGAGAAGAAGTCTGTGAGGTTTAATTTACAAGAAGATCATCAAAACAGTGGTAAAAGAGTTGATGGTGGTGATTCTAAAACTGGTGGGGCTGTGAGGATTAGACTGGTTGTCACACAGGAGGAGCTGAAACAGCTGCTGAATTATAAGAAAGATTCAAACCACTCATCTTTGGAGGAATTGTTGAATGCTGTCAAATCCAGAGGAACTAGGGTGTCTGAAATTAATGGAACAAGTAGTGATGATGAAAGCATAAGCAGTGGTGGTTGCTGGAGGCCAACTTTAGAGAGCATTCCAGAGGATCAACATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4228

Protein Analysis

146

Amino Acids

16.12

Weight (kDa)

6.44

Isoelectric Point (pI)

56.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 273
AclWI GGATC 1 cut(s) 435
AcsI RAATTY 1 cut(s) 118
AgsI TTSAA 3 cut(s) 124, 285, 313
AhdI GACNNNNNGTC 1 cut(s) 236
AluBI AGCT 2 cut(s) 253, 262
AluI AGCT 2 cut(s) 253, 262
AlwI GGATC 1 cut(s) 435
AlwNI CAGNNNCTG 1 cut(s) 265
AoxI GGCC 1 cut(s) 401
ApeKI GCWGC 2 cut(s) 62, 262
ApoI RAATTY 1 cut(s) 118
AseI ATTAAT 1 cut(s) 351
AsuHPI GGTGA 1 cut(s) 209
BbvI GCAGC 2 cut(s) 74, 249
BccI CCATC 1 cut(s) 185
BceAI ACGGC 1 cut(s) 97
BfaI CTAG 1 cut(s) 336
BisI GCNGC 2 cut(s) 63, 263
BlsI GCNGC 2 cut(s) 64, 264
BmeRI GACNNNNNGTC 1 cut(s) 236
BmsI GCATC 1 cut(s) 44
BpmI CTGGAG 1 cut(s) 418
BsaXI ACNNNNNCTCC 4 cut(s) 122, 152, 293, 323
Bse1I ACTGG 2 cut(s) 214, 237
Bse3DI GCAATG 2 cut(s) 107, 108
BseMI GCAATG 2 cut(s) 107, 108
BseNI ACTGG 2 cut(s) 214, 237
BseRI GAGGAG 1 cut(s) 263
BseXI GCAGC 2 cut(s) 74, 249
BshFI GGCC 1 cut(s) 403
BsmI GAATGC 2 cut(s) 319, 417
BsnI GGCC 1 cut(s) 403
Bsp143I GATC 2 cut(s) 163, 427
BspANI GGCC 1 cut(s) 403
BspPI GGATC 1 cut(s) 435
BsrDI GCAATG 2 cut(s) 107, 108
BsrI ACTGG 2 cut(s) 214, 237
BssMI GATC 2 cut(s) 163, 427
Bst4CI ACNGT 1 cut(s) 176
BstKTI GATC 2 cut(s) 166, 430
BstMBI GATC 2 cut(s) 163, 427
BstMWI GCNNNNNNNGC 2 cut(s) 71, 259
BstV1I GCAGC 2 cut(s) 74, 249
BsuRI GGCC 1 cut(s) 403
BtsI GCAGTG 1 cut(s) 391
BtsIMutI CAGTG 2 cut(s) 181, 391
CaiI CAGNNNCTG 1 cut(s) 265
CviAII CATG 1 cut(s) 56
CviJI RGCY 5 cut(s) 89, 218, 253, 262, 403
CviKI_1 RGCY 5 cut(s) 89, 218, 253, 262, 403
DpnI GATC 2 cut(s) 165, 429
DpnII GATC 2 cut(s) 163, 427
DriI GACNNNNNGTC 1 cut(s) 236
Eam1105I GACNNNNNGTC 1 cut(s) 236
FaeI CATG 1 cut(s) 59
FaiI YATR 4 cut(s) 48, 57, 273, 380
FatI CATG 1 cut(s) 55
Fnu4HI GCNGC 2 cut(s) 63, 263
Fsp4HI GCNGC 2 cut(s) 63, 263
FspBI CTAG 1 cut(s) 336
GluI GCNGC 2 cut(s) 63, 263
GsuI CTGGAG 1 cut(s) 418
HaeIII GGCC 1 cut(s) 403
Hin1II CATG 1 cut(s) 59
HinfI GANTC 2 cut(s) 200, 281
HphI GGTGA 1 cut(s) 209
Hpy188I TCNGA 1 cut(s) 346
Hpy188III TCNNGA 2 cut(s) 327, 422
Hpy99I CGWCG 1 cut(s) 118
HpyCH4III ACNGT 1 cut(s) 176
HpyCH4V TGCA 1 cut(s) 35
HpyF10VI GCNNNNNNNGC 2 cut(s) 71, 259
Hsp92II CATG 1 cut(s) 59
Kzo9I GATC 2 cut(s) 163, 427
LmnI GCTCC 1 cut(s) 250
LpnPI CCDG 8 cut(s) 96, 103, 113, 195, 218, 230, 340, 382
Lsp1109I GCAGC 2 cut(s) 74, 249
LweI GCATC 1 cut(s) 44
MaeI CTAG 1 cut(s) 336
MaeIII GTNAC 1 cut(s) 238
MalI GATC 2 cut(s) 165, 429
MboI GATC 2 cut(s) 163, 427
MboII GAAGA 2 cut(s) 145, 173
MluCI AATT 6 cut(s) 7, 118, 151, 268, 305, 348
MnlI CCTC 7 cut(s) 138, 216, 241, 295, 323, 393, 418
MseI TTAA 2 cut(s) 150, 351
MspA1I CMGCKG 1 cut(s) 262
Mva1269I GAATGC 2 cut(s) 319, 417
MwoI GCNNNNNNNGC 2 cut(s) 71, 259
NdeII GATC 2 cut(s) 163, 427
NlaIII CATG 1 cut(s) 59
NmuCI GTSAC 1 cut(s) 238
PctI GAATGC 2 cut(s) 319, 417
PfeI GAWTC 2 cut(s) 200, 281
PkrI GCNGC 2 cut(s) 64, 264
PshBI ATTAAT 1 cut(s) 351
PsiI TTATAA 1 cut(s) 273
PstNI CAGNNNCTG 1 cut(s) 265
PvuII CAGCTG 1 cut(s) 262
SaqAI TTAA 2 cut(s) 150, 351
SatI GCNGC 2 cut(s) 63, 263
Sau3AI GATC 2 cut(s) 163, 427
SetI ASST 3 cut(s) 149, 255, 264
SfaNI GCATC 1 cut(s) 44
Sse9I AATT 6 cut(s) 7, 118, 151, 268, 305, 348
SspMI CTAG 1 cut(s) 336
TaaI ACNGT 1 cut(s) 176
TaqI TCGA 1 cut(s) 116
TasI AATT 6 cut(s) 7, 118, 151, 268, 305, 348
TfiI GAWTC 2 cut(s) 200, 281
Tru1I TTAA 2 cut(s) 150, 351
Tru9I TTAA 2 cut(s) 150, 351
TscAI CASTG 2 cut(s) 181, 391
TseFI GTSAC 1 cut(s) 238
TseI GCWGC 2 cut(s) 62, 262
Tsp45I GTSAC 1 cut(s) 238
TspDTI ATGAA 2 cut(s) 72, 387
TspRI CASTG 2 cut(s) 181, 391
VspI ATTAAT 1 cut(s) 351
XapI RAATTY 1 cut(s) 118
XspI CTAG 1 cut(s) 336
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.