MD09G1268500.v1.1

Belongs to the DEAD box helicase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
OG0022346
Physical Location & Seq
Forward (+)
34281532 .. 34281729
198 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1268500.v1.1.491

Sequence Viewer

Length: 198 bp
ATGAAGAGGAAGTTTATGACGAACCCTGTAAGGATCATTGTCAAGCGTGACAAGTTGACTTTGGAGGGAATCAAGCAATTTTTCGTTTTGGTTGAAAGAGAAGAATGGAAATTTGATACGCTATGCGATCTCTATGATACTTTTACAATTACACAAGCTGTTATTTCTGCAACACAAAGCGAAAGGTTGATTAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0000003 GO:0000166 GO:0000184 GO:0000375 GO:0000377 GO:0000381 GO:0000398 GO:0000578 GO:0000956 GO:0001501 GO:0003002 GO:0003006 GO:0003008 GO:0003674 GO:0003676 GO:0003723 GO:0003724 GO:0003727 GO:0003729 GO:0003824 GO:0004004 GO:0004386 GO:0005488 GO:0005515 GO:0005524 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005681 GO:0005730 GO:0005737 GO:0005829 GO:0006139 GO:0006325 GO:0006355 GO:0006357 GO:0006396 GO:0006397 GO:0006401 GO:0006402 GO:0006403 GO:0006405 GO:0006406 GO:0006417 GO:0006448 GO:0006611 GO:0006725 GO:0006807 GO:0006810 GO:0006886 GO:0006913 GO:0006996 GO:0007028 GO:0007275 GO:0007276 GO:0007281 GO:0007292 GO:0007308 GO:0007309 GO:0007314 GO:0007315 GO:0007316 GO:0007350 GO:0007351 GO:0007389 GO:0007610 GO:0007611 GO:0007612 GO:0008026 GO:0008104 GO:0008143 GO:0008144 GO:0008150 GO:0008152 GO:0008186 GO:0008298 GO:0008306 GO:0008358 GO:0008380 GO:0008595 GO:0009056 GO:0009057 GO:0009653 GO:0009719 GO:0009790 GO:0009792 GO:0009798 GO:0009880 GO:0009887 GO:0009889 GO:0009890 GO:0009891 GO:0009892 GO:0009893 GO:0009948 GO:0009952 GO:0009966 GO:0009968 GO:0009987 GO:0009994 GO:0010033 GO:0010035 GO:0010467 GO:0010468 GO:0010501 GO:0010556 GO:0010557 GO:0010558 GO:0010604 GO:0010605 GO:0010608 GO:0010628 GO:0010629 GO:0010646 GO:0010648 GO:0014070 GO:0015031 GO:0015833 GO:0015931 GO:0016043 GO:0016070 GO:0016071 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017076 GO:0017111 GO:0017148 GO:0019094 GO:0019219 GO:0019222 GO:0019439 GO:0019953 GO:0021700 GO:0022412 GO:0022414 GO:0022607 GO:0023051 GO:0023057 GO:0030154 GO:0030425 GO:0030554 GO:0031123 GO:0031124 GO:0031323 GO:0031324 GO:0031325 GO:0031326 GO:0031327 GO:0031328 GO:0031503 GO:0031644 GO:0031645 GO:0031974 GO:0031981 GO:0032268 GO:0032269 GO:0032270 GO:0032501 GO:0032502 GO:0032504 GO:0032553 GO:0032555 GO:0032559 GO:0032991 GO:0033036 GO:0033120 GO:0034248 GO:0034249 GO:0034250 GO:0034613 GO:0034641 GO:0034655 GO:0035145 GO:0035282 GO:0035368 GO:0035613 GO:0035639 GO:0035640 GO:0036094 GO:0036477 GO:0042221 GO:0042391 GO:0042623 GO:0042886 GO:0042995 GO:0043005 GO:0043009 GO:0043021 GO:0043025 GO:0043167 GO:0043168 GO:0043170 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0043484 GO:0043933 GO:0044057 GO:0044085 GO:0044092 GO:0044237 GO:0044238 GO:0044248 GO:0044260 GO:0044265 GO:0044270 GO:0044297 GO:0044422 GO:0044424 GO:0044428 GO:0044444 GO:0044446 GO:0044463 GO:0044464 GO:0044703 GO:0044877 GO:0045184 GO:0045451 GO:0045495 GO:0045727 GO:0045893 GO:0045900 GO:0045935 GO:0045944 GO:0046483 GO:0046700 GO:0046907 GO:0048024 GO:0048026 GO:0048468 GO:0048469 GO:0048477 GO:0048513 GO:0048518 GO:0048519 GO:0048522 GO:0048523 GO:0048562 GO:0048568 GO:0048583 GO:0048585 GO:0048598 GO:0048599 GO:0048609 GO:0048701 GO:0048704 GO:0048705 GO:0048706 GO:0048731 GO:0048856 GO:0048869 GO:0050657 GO:0050658 GO:0050684 GO:0050685 GO:0050789 GO:0050794 GO:0050804 GO:0050805 GO:0050877 GO:0050890 GO:0050896 GO:0051028 GO:0051098 GO:0051100 GO:0051168 GO:0051169 GO:0051171 GO:0051172 GO:0051173 GO:0051179 GO:0051234 GO:0051236 GO:0051239 GO:0051241 GO:0051246 GO:0051247 GO:0051248 GO:0051252 GO:0051254 GO:0051276 GO:0051641 GO:0051649 GO:0051704 GO:0051716 GO:0060255 GO:0060810 GO:0060811 GO:0065003 GO:0065007 GO:0065008 GO:0065009 GO:0070013 GO:0070035 GO:0070717 GO:0070727 GO:0070848 GO:0070887 GO:0071013 GO:0071166 GO:0071241 GO:0071310 GO:0071363 GO:0071426 GO:0071427 GO:0071495 GO:0071702 GO:0071704 GO:0071705 GO:0071840 GO:0072714 GO:0072715 GO:0080090 GO:0090304 GO:0090394 GO:0097159 GO:0097367 GO:0097447 GO:0097458 GO:0098815 GO:0099177 GO:0120025 GO:0120038 GO:0140098 GO:1901265 GO:1901360 GO:1901361 GO:1901363 GO:1901575 GO:1902415 GO:1902494 GO:1902680 GO:1903040 GO:1903311 GO:1903313 GO:1903506 GO:1903508 GO:1904569 GO:1904570 GO:1904572 GO:1904573 GO:1904574 GO:1904888 GO:1905214 GO:1905215 GO:1990089 GO:1990090 GO:1990416 GO:1990904 GO:2000112 GO:2000113 GO:2001141
KEGG Pathways
Metabolic & Signaling
ko03013 ko03015 ko03040 map03013 map03015 map03040
Pfam Domains
Protein Families
DEAD Helicase_C

Protein Analysis

66

Amino Acids

7.74

Weight (kDa)

8.93

Isoelectric Point (pI)

31.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022346)

Species Orthologous Gene IDs
malus_domestica MD09G1268500.v1.1
rosa_chinensis RchiOBHm_Chr0c44g0503491 RchiOBHm_Chr4g0386191 RchiOBHm_Chr4g0386311

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 41
AcsI RAATTY 1 cut(s) 110
AgsI TTSAA 1 cut(s) 95
AluBI AGCT 2 cut(s) 158, 195
AluI AGCT 2 cut(s) 158, 195
AlwI GGATC 1 cut(s) 41
ApoI RAATTY 1 cut(s) 110
Bsp143I GATC 2 cut(s) 33, 127
BspPI GGATC 1 cut(s) 41
BssMI GATC 2 cut(s) 33, 127
BstKTI GATC 2 cut(s) 36, 130
BstMBI GATC 2 cut(s) 33, 127
CviJI RGCY 2 cut(s) 158, 195
CviKI_1 RGCY 2 cut(s) 158, 195
DpnI GATC 2 cut(s) 35, 129
DpnII GATC 2 cut(s) 33, 127
FaiI YATR 3 cut(s) 17, 124, 135
FspEI CC 9 cut(s) 16, 38, 39, 47, 50, 51, 74, 91, 169
HincII GTYRAC 1 cut(s) 57
HindII GTYRAC 1 cut(s) 57
HinfI GANTC 1 cut(s) 69
Hpy166II GTNNAC 1 cut(s) 57
Hpy8I GTNNAC 1 cut(s) 57
HpyCH4V TGCA 1 cut(s) 170
Kzo9I GATC 2 cut(s) 33, 127
LpnPI CCDG 1 cut(s) 39
MaeIII GTNAC 1 cut(s) 47
MalI GATC 2 cut(s) 35, 129
MboI GATC 2 cut(s) 33, 127
MboII GAAGA 2 cut(s) 16, 113
MluCI AATT 3 cut(s) 77, 110, 147
MnlI CCTC 1 cut(s) 58
NdeII GATC 2 cut(s) 33, 127
NmuCI GTSAC 1 cut(s) 47
PfeI GAWTC 1 cut(s) 69
Sau3AI GATC 2 cut(s) 33, 127
SetI ASST 3 cut(s) 160, 188, 197
SgeI CNNG 6 cut(s) 38, 55, 59, 64, 85, 167
Sse9I AATT 3 cut(s) 77, 110, 147
TasI AATT 3 cut(s) 77, 110, 147
TfiI GAWTC 1 cut(s) 69
TseFI GTSAC 1 cut(s) 47
Tsp45I GTSAC 1 cut(s) 47
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.