RchiOBHm_Chr4g0386311

Eukaryotic initiation factor

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
1809833 .. 1810124
292 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35968

Sequence Viewer

Length: 186 bp
ATGGAGACCTACAGACATCTACAAGATACCCTACAAGTTTGCTGGATCTCCACGACGCTCTCTAATGAAATTTTGGAGATGACCAACAAGTTCATGACCAATCCTATAAGGATCCTGGTTAAACGTGACGAGCTGACTTTGGAGGGAATCAAGCAATTTTTCGTTGCAGTTGAAAAAGAAGATTAG

Protein Analysis

61

Amino Acids

7.26

Weight (kDa)

5.0

Isoelectric Point (pI)

39.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022346)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 53, 106, 119
AcsI RAATTY 1 cut(s) 69
AgsI TTSAA 1 cut(s) 173
AjnI CCWGG 1 cut(s) 114
AluBI AGCT 1 cut(s) 133
AluI AGCT 1 cut(s) 133
AlwI GGATC 3 cut(s) 53, 106, 119
ApoI RAATTY 1 cut(s) 69
BamHI GGATCC 1 cut(s) 111
BciT130I CCWGG 1 cut(s) 116
BfmI CTRYAG 1 cut(s) 10
Bme1390I CCNGG 1 cut(s) 116
BmiI GGNNCC 1 cut(s) 113
BmrFI CCNGG 1 cut(s) 116
BseBI CCWGG 1 cut(s) 116
Bsp143I GATC 2 cut(s) 45, 111
BspHI TCATGA 1 cut(s) 93
BspLI GGNNCC 1 cut(s) 113
BspPI GGATC 3 cut(s) 53, 106, 119
BssMI GATC 2 cut(s) 45, 111
Bst2UI CCWGG 1 cut(s) 116
BstKTI GATC 2 cut(s) 48, 114
BstMBI GATC 2 cut(s) 45, 111
BstNI CCWGG 1 cut(s) 116
BstSCI CCNGG 1 cut(s) 114
BstSFI CTRYAG 1 cut(s) 10
BstX2I RGATCY 2 cut(s) 45, 111
BstYI RGATCY 2 cut(s) 45, 111
CciI TCATGA 1 cut(s) 93
CseI GACGC 1 cut(s) 64
CviAII CATG 1 cut(s) 94
CviJI RGCY 1 cut(s) 133
CviKI_1 RGCY 1 cut(s) 133
DpnI GATC 2 cut(s) 47, 113
DpnII GATC 2 cut(s) 45, 111
EcoRII CCWGG 1 cut(s) 114
FaeI CATG 1 cut(s) 97
FaiI YATR 2 cut(s) 95, 107
FatI CATG 1 cut(s) 93
HgaI GACGC 1 cut(s) 64
Hin1II CATG 1 cut(s) 97
HinfI GANTC 1 cut(s) 147
Hpy188III TCNNGA 1 cut(s) 94
Hpy99I CGWCG 1 cut(s) 58
HpyCH4IV ACGT 1 cut(s) 124
HpyCH4V TGCA 1 cut(s) 167
HpySE526I ACGT 1 cut(s) 124
Hsp92II CATG 1 cut(s) 97
Kzo9I GATC 2 cut(s) 45, 111
LpnPI CCDG 3 cut(s) 28, 101, 128
MaeII ACGT 1 cut(s) 124
MaeIII GTNAC 1 cut(s) 125
MalI GATC 2 cut(s) 47, 113
MboI GATC 2 cut(s) 45, 111
MflI RGATCY 2 cut(s) 45, 111
MluCI AATT 2 cut(s) 69, 155
MnlI CCTC 1 cut(s) 136
MseI TTAA 1 cut(s) 120
MspR9I CCNGG 1 cut(s) 116
MvaI CCWGG 1 cut(s) 116
NdeII GATC 2 cut(s) 45, 111
NlaIII CATG 1 cut(s) 97
NlaIV GGNNCC 1 cut(s) 113
NmuCI GTSAC 1 cut(s) 125
PagI TCATGA 1 cut(s) 93
PfeI GAWTC 1 cut(s) 147
Psp6I CCWGG 1 cut(s) 114
PspGI CCWGG 1 cut(s) 114
PspN4I GGNNCC 1 cut(s) 113
PsuI RGATCY 2 cut(s) 45, 111
SaqAI TTAA 1 cut(s) 120
Sau3AI GATC 2 cut(s) 45, 111
ScrFI CCNGG 1 cut(s) 116
SetI ASST 3 cut(s) 11, 127, 135
SfcI CTRYAG 1 cut(s) 10
Sse9I AATT 2 cut(s) 69, 155
StyD4I CCNGG 1 cut(s) 114
TaiI ACGT 1 cut(s) 127
TasI AATT 2 cut(s) 69, 155
TfiI GAWTC 1 cut(s) 147
Tru1I TTAA 1 cut(s) 120
Tru9I TTAA 1 cut(s) 120
TseFI GTSAC 1 cut(s) 125
Tsp45I GTSAC 1 cut(s) 125
TspDTI ATGAA 2 cut(s) 81, 82
XapI RAATTY 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.