MD10G1310000.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
OG0024215
Physical Location & Seq
Forward (+)
39464281 .. 39464543
263 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1310000.v1.1.491

Sequence Viewer

Length: 198 bp
ATGTGCATGTCGGTATCCAGGTTTAGACCTTTATGTTTGGCTCTAGAGGGGTTAGGTTTCATGTCCCCCCCTCTTTTCTTTGTTTCATTCTCATTTTTTGTTTCTATAAGGGTAAGGTTTATGTCCCCCCTTCTTTCTAGTGTATTCCTTTTTGTTGTCTCTGTTTTTTGGAGGGGTAAGGTGTATGTCCCCCCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.46

Weight (kDa)

10.81

Isoelectric Point (pI)

64.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024215)

Species Orthologous Gene IDs
malus_domestica MD10G1310000.v1.1
pyrus_communis pycom01g00460 pycom05g09370

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 17
Alw26I GTCTC 1 cut(s) 163
BciT130I CCWGG 1 cut(s) 19
BciVI GTATCC 1 cut(s) 25
BcoDI GTCTC 1 cut(s) 163
BfaI CTAG 2 cut(s) 44, 138
BfuI GTATCC 1 cut(s) 25
Bme1390I CCNGG 1 cut(s) 19
BmrFI CCNGG 1 cut(s) 19
BseBI CCWGG 1 cut(s) 19
BslFI GGGAC 3 cut(s) 49, 109, 173
BsmAI GTCTC 1 cut(s) 163
BsmFI GGGAC 3 cut(s) 49, 109, 173
Bst2UI CCWGG 1 cut(s) 19
BstMAI GTCTC 1 cut(s) 163
BstNI CCWGG 1 cut(s) 19
BstNSI RCATGY 1 cut(s) 10
BstSCI CCNGG 1 cut(s) 17
BsuI GTATCC 1 cut(s) 25
CviAII CATG 2 cut(s) 7, 61
CviJI RGCY 1 cut(s) 41
CviKI_1 RGCY 1 cut(s) 41
EcoRII CCWGG 1 cut(s) 17
FaeI CATG 2 cut(s) 10, 64
FaiI YATR 6 cut(s) 8, 34, 62, 107, 122, 186
FaqI GGGAC 3 cut(s) 49, 109, 173
FatI CATG 2 cut(s) 6, 60
FspBI CTAG 2 cut(s) 44, 138
Hin1II CATG 2 cut(s) 10, 64
Hpy188III TCNNGA 1 cut(s) 44
HpyAV CCTTC 1 cut(s) 140
HpyCH4V TGCA 1 cut(s) 6
Hsp92II CATG 2 cut(s) 10, 64
LpnPI CCDG 2 cut(s) 4, 31
MaeI CTAG 2 cut(s) 44, 138
MnlI CCTC 3 cut(s) 40, 81, 165
MspR9I CCNGG 1 cut(s) 19
MvaI CCWGG 1 cut(s) 19
NlaIII CATG 2 cut(s) 10, 64
NspI RCATGY 1 cut(s) 10
Psp6I CCWGG 1 cut(s) 17
PspGI CCWGG 1 cut(s) 17
ScrFI CCNGG 1 cut(s) 19
SetI ASST 5 cut(s) 23, 31, 58, 119, 183
SgeI CNNG 6 cut(s) 19, 30, 31, 56, 73, 150
SspMI CTAG 2 cut(s) 44, 138
StyD4I CCNGG 1 cut(s) 17
TspDTI ATGAA 2 cut(s) 49, 75
XbaI TCTAGA 1 cut(s) 43
XceI RCATGY 1 cut(s) 10
XspI CTAG 2 cut(s) 44, 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.