MD11G1135300.v1.1

disease resistance

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
OG0024494
Physical Location & Seq
Forward (+)
12429614 .. 12429883
270 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1135300.v1.1.491

Sequence Viewer

Length: 270 bp
ATGACAGATTTGAATTTGCTTCAAGTTGAACTTAGAGAACAATTGAGGGGAAAGAAATTCTTATTTGTGTTGGATGACCTTTGGAATGAGAAATATTTTGATTGGAAGTGCCTGCAAACTCCTTTTACTTCTGGGGCAAGAGGAAGTAAAGTCACCATGACAACACAAAGCGAAAATGTCGCATCTCTCATGAAAAATGTTCCCATTCAATACGTGGAACCTTTGTCGCATGAAGATTGTTGGATGTTCCTTGCAAAACATGCATTTTGA

Protein Analysis

90

Amino Acids

10.46

Weight (kDa)

6.06

Isoelectric Point (pI)

43.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NB-ARC PF00931 7 - 89 9.3e-17 NB-ARC domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024494)

Species Orthologous Gene IDs
malus_domestica MD11G1135300.v1.1
rosa_rugosa Rorug02G0470600
rosa_samantha Rh2CG520000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 13, 56
AgsI TTSAA 4 cut(s) 13, 23, 29, 209
ApoI RAATTY 2 cut(s) 13, 56
AsuHPI GGTGA 1 cut(s) 145
BmiI GGNNCC 1 cut(s) 219
BmsI GCATC 1 cut(s) 191
BsaAI YACGTR 1 cut(s) 214
BseGI GGATG 2 cut(s) 79, 249
BspHI TCATGA 1 cut(s) 189
BspLI GGNNCC 1 cut(s) 219
BstAPI GCANNNNNTGC 1 cut(s) 260
BstBAI YACGTR 1 cut(s) 214
BstC8I GCNNGC 1 cut(s) 113
BstDEI CTNAG 1 cut(s) 32
BstF5I GGATG 2 cut(s) 79, 249
BstMWI GCNNNNNNNGC 1 cut(s) 260
BstNSI RCATGY 1 cut(s) 263
BtsCI GGATG 2 cut(s) 79, 249
Cac8I GCNNGC 1 cut(s) 113
CciI TCATGA 1 cut(s) 189
CviAII CATG 4 cut(s) 157, 190, 230, 260
DdeI CTNAG 1 cut(s) 32
EcoT22I ATGCAT 1 cut(s) 265
FaeI CATG 4 cut(s) 160, 193, 233, 263
FaiI YATR 4 cut(s) 158, 191, 231, 261
FalI AAGNNNNNCTT 4 cut(s) 15, 47, 44, 76
FatI CATG 4 cut(s) 156, 189, 229, 259
FokI GGATG 2 cut(s) 86, 256
Hin1II CATG 4 cut(s) 160, 193, 233, 263
HphI GGTGA 1 cut(s) 145
Hpy188III TCNNGA 1 cut(s) 190
HpyCH4IV ACGT 1 cut(s) 213
HpyCH4V TGCA 3 cut(s) 115, 254, 263
HpyF10VI GCNNNNNNNGC 1 cut(s) 260
HpyF3I CTNAG 1 cut(s) 32
HpySE526I ACGT 1 cut(s) 213
Hsp92II CATG 4 cut(s) 160, 193, 233, 263
LpnPI CCDG 2 cut(s) 117, 125
LweI GCATC 1 cut(s) 191
MaeII ACGT 1 cut(s) 213
MaeIII GTNAC 1 cut(s) 151
MboII GAAGA 1 cut(s) 245
MfeI CAATTG 1 cut(s) 41
MluCI AATT 3 cut(s) 13, 41, 56
MmeI TCCRAC 2 cut(s) 51, 221
MnlI CCTC 2 cut(s) 39, 134
Mph1103I ATGCAT 1 cut(s) 265
MunI CAATTG 1 cut(s) 41
MwoI GCNNNNNNNGC 1 cut(s) 260
NlaIII CATG 4 cut(s) 160, 193, 233, 263
NlaIV GGNNCC 1 cut(s) 219
NmuCI GTSAC 1 cut(s) 151
NsiI ATGCAT 1 cut(s) 265
NspI RCATGY 1 cut(s) 263
PagI TCATGA 1 cut(s) 189
Ppu21I YACGTR 1 cut(s) 214
PspN4I GGNNCC 1 cut(s) 219
SetI ASST 3 cut(s) 81, 216, 223
SfaNI GCATC 1 cut(s) 191
SgeI CNNG 9 cut(s) 35, 124, 144, 150, 169, 202, 226, 242, 263
Sse9I AATT 3 cut(s) 13, 41, 56
SspI AATATT 1 cut(s) 95
TaiI ACGT 1 cut(s) 216
TasI AATT 3 cut(s) 13, 41, 56
TseFI GTSAC 1 cut(s) 151
Tsp45I GTSAC 1 cut(s) 151
TspDTI ATGAA 2 cut(s) 206, 246
XapI RAATTY 2 cut(s) 13, 56
XceI RCATGY 1 cut(s) 263
XcmI CCANNNNNNNNNTGG 1 cut(s) 211
Zsp2I ATGCAT 1 cut(s) 265
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.