MD11G1186700.v1.1

phosphatase 2C

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
OG0028928
Physical Location & Seq
Forward (+)
25501926 .. 25503925
2000 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1186700.v1.1.491

Sequence Viewer

Length: 189 bp
ATGTTTGATAAATTATTTTTTTTTTGGTCAAAAAGAAAAGCATGTGATTTTTGTTACTCAAACTCTCATTCGGGACTGCTACATGGTTCTAATGAAGCATGTCATTTGAAAGAGATTGTTTTAACCAAGGAACCCGAACCCACCAATGCACAGGAGCGTACAAGAGCCTGCTCGTATTCAAAAGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PP2C

Protein Analysis

63

Amino Acids

7.15

Weight (kDa)

8.42

Isoelectric Point (pI)

49.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0028928)

Species Orthologous Gene IDs
malus_domestica MD11G1186700.v1.1
pyrus_communis pycom1146g00080

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 160
AgsI TTSAA 2 cut(s) 109, 180
BmiI GGNNCC 1 cut(s) 132
BsaJI CCNNGG 1 cut(s) 126
BseDI CCNNGG 1 cut(s) 126
BslFI GGGAC 1 cut(s) 87
BsmFI GGGAC 1 cut(s) 87
BspLI GGNNCC 1 cut(s) 132
BssECI CCNNGG 1 cut(s) 126
BssT1I CCWWGG 1 cut(s) 126
BstC8I GCNNGC 1 cut(s) 169
BstNSI RCATGY 2 cut(s) 45, 102
Cac8I GCNNGC 1 cut(s) 169
Csp6I GTAC 1 cut(s) 159
CviAII CATG 3 cut(s) 42, 83, 99
CviJI RGCY 1 cut(s) 167
CviKI_1 RGCY 1 cut(s) 167
CviQI GTAC 1 cut(s) 159
Eco130I CCWWGG 1 cut(s) 126
EcoT14I CCWWGG 1 cut(s) 126
ErhI CCWWGG 1 cut(s) 126
FaeI CATG 3 cut(s) 45, 86, 102
FaiI YATR 3 cut(s) 43, 84, 100
FaqI GGGAC 1 cut(s) 87
FatI CATG 3 cut(s) 41, 82, 98
Hin1II CATG 3 cut(s) 45, 86, 102
Hpy188III TCNNGA 1 cut(s) 72
HpyCH4V TGCA 1 cut(s) 149
Hsp92II CATG 3 cut(s) 45, 86, 102
LmnI GCTCC 1 cut(s) 154
LpnPI CCDG 2 cut(s) 137, 181
MaeIII GTNAC 1 cut(s) 53
MluCI AATT 1 cut(s) 11
MseI TTAA 1 cut(s) 122
NlaIII CATG 3 cut(s) 45, 86, 102
NlaIV GGNNCC 1 cut(s) 132
NspI RCATGY 2 cut(s) 45, 102
PspN4I GGNNCC 1 cut(s) 132
RsaI GTAC 1 cut(s) 160
RsaNI GTAC 1 cut(s) 159
SaqAI TTAA 1 cut(s) 122
Sse9I AATT 1 cut(s) 11
StyI CCWWGG 1 cut(s) 126
TasI AATT 1 cut(s) 11
Tru1I TTAA 1 cut(s) 122
Tru9I TTAA 1 cut(s) 122
TspDTI ATGAA 1 cut(s) 108
XceI RCATGY 2 cut(s) 45, 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.