pycom1146g00080

phosphatase 2C

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00001146
Physical Location & Seq
Reverse (-)
124648 .. 127202
2555 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom1146g00080.2

Sequence Viewer

Length: 186 bp
ATGTGGTTAGAGGCTGAGAACAGAAGATTCAGGAGTAAAGACCTCCTGACAATCATCAAAGATCAACGGTTAAGACTTGGATTGCTTCATGGTTCGAATGAAGCATGTCATCTGAAAGAGATTGTTTTAACTAGGGAACCCAAAGCCACCTATGCACAGGAGCGTGCACGTATTCAGAAGTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

7.25

Weight (kDa)

9.78

Isoelectric Point (pI)

51.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0028928)

Species Orthologous Gene IDs
malus_domestica MD11G1186700.v1.1
pyrus_communis pycom1146g00080

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Alw21I GWGCWC 1 cut(s) 169
Alw44I GTGCAC 1 cut(s) 165
ApaLI GTGCAC 1 cut(s) 165
AsuII TTCGAA 1 cut(s) 95
BaeGI GKGCMC 1 cut(s) 169
Bbv12I GWGCWC 1 cut(s) 169
BfaI CTAG 1 cut(s) 132
BmiI GGNNCC 1 cut(s) 138
Bpu14I TTCGAA 1 cut(s) 95
BsaAI YACGTR 1 cut(s) 170
BseMII CTCAG 1 cut(s) 6
BseSI GKGCMC 1 cut(s) 169
BsiHKAI GWGCWC 1 cut(s) 169
Bsp119I TTCGAA 1 cut(s) 95
Bsp1286I GDGCHC 1 cut(s) 169
Bsp143I GATC 1 cut(s) 61
BspCNI CTCAG 1 cut(s) 7
BspLI GGNNCC 1 cut(s) 138
BspT104I TTCGAA 1 cut(s) 95
BssMI GATC 1 cut(s) 61
Bst4CI ACNGT 1 cut(s) 69
BstBAI YACGTR 1 cut(s) 170
BstBI TTCGAA 1 cut(s) 95
BstC8I GCNNGC 1 cut(s) 165
BstDEI CTNAG 1 cut(s) 15
BstKTI GATC 1 cut(s) 64
BstMBI GATC 1 cut(s) 61
BstMWI GCNNNNNNNGC 1 cut(s) 152
BstNSI RCATGY 1 cut(s) 108
BstSLI GKGCMC 1 cut(s) 169
Cac8I GCNNGC 1 cut(s) 165
CviAII CATG 2 cut(s) 89, 105
CviJI RGCY 2 cut(s) 14, 146
CviKI_1 RGCY 2 cut(s) 14, 146
DdeI CTNAG 1 cut(s) 15
DpnI GATC 1 cut(s) 63
DpnII GATC 1 cut(s) 61
FaeI CATG 2 cut(s) 92, 108
FaiI YATR 3 cut(s) 90, 106, 153
FatI CATG 2 cut(s) 88, 104
FspBI CTAG 1 cut(s) 132
Hin1II CATG 2 cut(s) 92, 108
HinfI GANTC 1 cut(s) 27
Hpy166II GTNNAC 1 cut(s) 167
Hpy188I TCNGA 2 cut(s) 114, 177
Hpy188III TCNNGA 2 cut(s) 31, 46
Hpy8I GTNNAC 1 cut(s) 167
HpyCH4III ACNGT 1 cut(s) 69
HpyCH4IV ACGT 1 cut(s) 169
HpyCH4V TGCA 2 cut(s) 155, 167
HpyF10VI GCNNNNNNNGC 1 cut(s) 152
HpyF3I CTNAG 1 cut(s) 15
HpySE526I ACGT 1 cut(s) 169
Hsp92II CATG 2 cut(s) 92, 108
Kzo9I GATC 1 cut(s) 61
LmnI GCTCC 1 cut(s) 160
LpnPI CCDG 3 cut(s) 16, 59, 143
MaeI CTAG 1 cut(s) 132
MaeII ACGT 1 cut(s) 169
MalI GATC 1 cut(s) 63
MboI GATC 1 cut(s) 61
MboII GAAGA 1 cut(s) 36
MhlI GDGCHC 1 cut(s) 169
MnlI CCTC 2 cut(s) 4, 53
MseI TTAA 2 cut(s) 71, 128
MwoI GCNNNNNNNGC 1 cut(s) 152
NdeII GATC 1 cut(s) 61
NlaIII CATG 2 cut(s) 92, 108
NlaIV GGNNCC 1 cut(s) 138
NspI RCATGY 1 cut(s) 108
NspV TTCGAA 1 cut(s) 95
PfeI GAWTC 1 cut(s) 27
Ppu21I YACGTR 1 cut(s) 170
PspN4I GGNNCC 1 cut(s) 138
SaqAI TTAA 2 cut(s) 71, 128
Sau3AI GATC 1 cut(s) 61
SduI GDGCHC 1 cut(s) 169
SetI ASST 3 cut(s) 45, 152, 172
SfuI TTCGAA 1 cut(s) 95
SgeI CNNG 9 cut(s) 43, 58, 89, 101, 117, 144, 170, 176, 180
SspMI CTAG 1 cut(s) 132
TaaI ACNGT 1 cut(s) 69
TaiI ACGT 1 cut(s) 172
TaqI TCGA 1 cut(s) 95
TfiI GAWTC 1 cut(s) 27
Tru1I TTAA 2 cut(s) 71, 128
Tru9I TTAA 2 cut(s) 71, 128
TspDTI ATGAA 2 cut(s) 77, 114
VneI GTGCAC 1 cut(s) 165
XceI RCATGY 1 cut(s) 108
XspI CTAG 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.