MD11G1240400.v1.1

Zinc finger BED domain-containing protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Forward (+)
34967301 .. 34968058
758 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1240400.v1.1.491

Sequence Viewer

Length: 255 bp
ATGGATGCTGTAGAGCAAGATTTTACAAACCTTAGTGATGGAGGGTCGGTGGAAGTGACAATGGGAATGCAACCTGATCATGGAAGTGAAAATACAGAAGATACAAATACAAGTCCGGCAAAGAAAAAGGCTAGAGTGATCAAATTAGACAAAGATTGGAAATTGCATAAGAGAATTTTAAGTTTTTGTCACATGCCTCCTCCTCATACTGGTGTTGCATTATCTGAGAAAATTAATGCATTGGTGACTGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

9.28

Weight (kDa)

5.74

Isoelectric Point (pI)

39.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021207)

Species Orthologous Gene IDs
malus_domestica MD11G1240400.v1.1
pyrus_communis pycom01g07040 pycom06g00120 pycom13g22940 pycom16g26070

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 174
AfiI CCNNNNNNNGG 2 cut(s) 80, 209
ApoI RAATTY 1 cut(s) 174
AseI ATTAAT 1 cut(s) 234
BarI GAAGNNNNNNTAC 2 cut(s) 76, 108
BccI CCATC 1 cut(s) 32
BclI TGATCA 2 cut(s) 76, 138
BfaI CTAG 1 cut(s) 132
BfmI CTRYAG 1 cut(s) 9
BsaXI ACNNNNNCTCC 2 cut(s) 33, 63
Bsc4I CCNNNNNNNGG 2 cut(s) 80, 209
Bse1I ACTGG 1 cut(s) 214
BseGI GGATG 1 cut(s) 10
BseLI CCNNNNNNNGG 2 cut(s) 80, 209
BseMII CTCAG 2 cut(s) 216, 240
BseNI ACTGG 1 cut(s) 214
BseRI GAGGAG 2 cut(s) 189, 192
BsiSI CCGG 1 cut(s) 116
BslI CCNNNNNNNGG 2 cut(s) 80, 209
BsmI GAATGC 1 cut(s) 72
Bsp143I GATC 2 cut(s) 76, 138
BspCNI CTCAG 2 cut(s) 217, 241
BsrI ACTGG 1 cut(s) 214
BssMI GATC 2 cut(s) 76, 138
BstDEI CTNAG 3 cut(s) 32, 225, 249
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 2 cut(s) 79, 141
BstMBI GATC 2 cut(s) 76, 138
BstNSI RCATGY 1 cut(s) 196
BstSFI CTRYAG 1 cut(s) 9
BtsCI GGATG 1 cut(s) 10
CviAII CATG 2 cut(s) 80, 193
CviJI RGCY 1 cut(s) 131
CviKI_1 RGCY 1 cut(s) 131
DdeI CTNAG 3 cut(s) 32, 225, 249
DpnI GATC 2 cut(s) 78, 140
DpnII GATC 2 cut(s) 76, 138
EcoT22I ATGCAT 1 cut(s) 241
FaeI CATG 2 cut(s) 83, 196
FaiI YATR 4 cut(s) 81, 168, 194, 207
FatI CATG 2 cut(s) 79, 192
FbaI TGATCA 2 cut(s) 76, 138
FokI GGATG 1 cut(s) 17
FspBI CTAG 1 cut(s) 132
HapII CCGG 1 cut(s) 116
Hin1II CATG 2 cut(s) 83, 196
HpaII CCGG 1 cut(s) 116
Hpy188I TCNGA 1 cut(s) 226
HpyCH4V TGCA 4 cut(s) 70, 166, 218, 239
HpyF3I CTNAG 3 cut(s) 32, 225, 249
Hsp92II CATG 2 cut(s) 83, 196
Ksp22I TGATCA 2 cut(s) 76, 138
Kzo9I GATC 2 cut(s) 76, 138
LpnPI CCDG 3 cut(s) 87, 129, 195
MaeI CTAG 1 cut(s) 132
MaeIII GTNAC 3 cut(s) 55, 188, 244
MalI GATC 2 cut(s) 78, 140
MboI GATC 2 cut(s) 76, 138
MboII GAAGA 1 cut(s) 110
MluCI AATT 4 cut(s) 143, 161, 174, 231
MnlI CCTC 4 cut(s) 35, 207, 210, 213
Mph1103I ATGCAT 1 cut(s) 241
MseI TTAA 2 cut(s) 179, 234
MslI CAYNNNNRTG 2 cut(s) 84, 210
MspI CCGG 1 cut(s) 116
Mva1269I GAATGC 1 cut(s) 72
NdeII GATC 2 cut(s) 76, 138
NlaIII CATG 2 cut(s) 83, 196
NmuCI GTSAC 3 cut(s) 55, 188, 244
NsiI ATGCAT 1 cut(s) 241
NspI RCATGY 1 cut(s) 196
PctI GAATGC 1 cut(s) 72
PshBI ATTAAT 1 cut(s) 234
RseI CAYNNNNRTG 2 cut(s) 84, 210
SaqAI TTAA 2 cut(s) 179, 234
Sau3AI GATC 2 cut(s) 76, 138
SetI ASST 2 cut(s) 33, 76
SfcI CTRYAG 1 cut(s) 9
SgeI CNNG 8 cut(s) 29, 86, 92, 123, 128, 144, 205, 222
SmiMI CAYNNNNRTG 2 cut(s) 84, 210
Sse9I AATT 4 cut(s) 143, 161, 174, 231
SspMI CTAG 1 cut(s) 132
TasI AATT 4 cut(s) 143, 161, 174, 231
Tru1I TTAA 2 cut(s) 179, 234
Tru9I TTAA 2 cut(s) 179, 234
TseFI GTSAC 3 cut(s) 55, 188, 244
Tsp45I GTSAC 3 cut(s) 55, 188, 244
VspI ATTAAT 1 cut(s) 234
XapI RAATTY 1 cut(s) 174
XceI RCATGY 1 cut(s) 196
XspI CTAG 1 cut(s) 132
Zsp2I ATGCAT 1 cut(s) 241
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.