MD11G1295300.v1.1

ATP synthase epsilon chain

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Forward (+)
41347738 .. 41347935
198 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1295300.v1.1.491

Sequence Viewer

Length: 198 bp
ATGGCTCTAATGGGTGGTTTTGCTAGAATAGGCAATAATGAGATCACGGTTTTAGTAAATGATGCAGAGAAGGGTAGTGACATTGATCCACAAGAAGCTCAACAAACTCTTGAAACAATGGAAGCTAATTTGAGGAAAGCTGAAGGCAAGAGACAAACAATTGAGGCAAATTTAGCTCTCAGACGAGCTAGGACATGA

Protein Analysis

66

Amino Acids

7.16

Weight (kDa)

5.31

Isoelectric Point (pI)

51.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ATP-synt_DE PF00401 27 - 64 3e-07 ATP synthase, Delta/Epsilon chain, long alpha-helix domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 80
AcsI RAATTY 1 cut(s) 169
AcuI CTGAAG 1 cut(s) 162
AgsI TTSAA 1 cut(s) 113
AluBI AGCT 5 cut(s) 98, 125, 140, 176, 188
AluI AGCT 5 cut(s) 98, 125, 140, 176, 188
Alw26I GTCTC 1 cut(s) 145
AlwI GGATC 1 cut(s) 80
ApoI RAATTY 1 cut(s) 169
BcoDI GTCTC 1 cut(s) 145
BfaI CTAG 2 cut(s) 24, 189
BmsI GCATC 1 cut(s) 52
BseMII CTCAG 1 cut(s) 193
BsmAI GTCTC 1 cut(s) 145
Bsp143I GATC 2 cut(s) 42, 85
BspCNI CTCAG 1 cut(s) 192
BspPI GGATC 1 cut(s) 80
BssMI GATC 2 cut(s) 42, 85
Bst4CI ACNGT 1 cut(s) 49
BstDEI CTNAG 1 cut(s) 179
BstKTI GATC 2 cut(s) 45, 88
BstMAI GTCTC 1 cut(s) 145
BstMBI GATC 2 cut(s) 42, 85
BstMWI GCNNNNNNNGC 1 cut(s) 173
CviAII CATG 1 cut(s) 195
CviJI RGCY 6 cut(s) 5, 98, 125, 140, 176, 188
CviKI_1 RGCY 6 cut(s) 5, 98, 125, 140, 176, 188
DdeI CTNAG 1 cut(s) 179
DpnI GATC 2 cut(s) 44, 87
DpnII GATC 2 cut(s) 42, 85
Eco57I CTGAAG 1 cut(s) 162
FaeI CATG 1 cut(s) 198
FaiI YATR 1 cut(s) 196
FatI CATG 1 cut(s) 194
FspBI CTAG 2 cut(s) 24, 189
Hin1II CATG 1 cut(s) 198
Hpy188I TCNGA 1 cut(s) 182
Hpy188III TCNNGA 1 cut(s) 110
HpyAV CCTTC 2 cut(s) 64, 137
HpyCH4III ACNGT 1 cut(s) 49
HpyCH4V TGCA 1 cut(s) 65
HpyF10VI GCNNNNNNNGC 1 cut(s) 173
HpyF3I CTNAG 1 cut(s) 179
Hsp92II CATG 1 cut(s) 198
Kzo9I GATC 2 cut(s) 42, 85
LweI GCATC 1 cut(s) 52
MaeI CTAG 2 cut(s) 24, 189
MaeIII GTNAC 1 cut(s) 77
MalI GATC 2 cut(s) 44, 87
MboI GATC 2 cut(s) 42, 85
MfeI CAATTG 1 cut(s) 159
MluCI AATT 3 cut(s) 127, 159, 169
MnlI CCTC 2 cut(s) 126, 157
MunI CAATTG 1 cut(s) 159
MwoI GCNNNNNNNGC 1 cut(s) 173
NdeII GATC 2 cut(s) 42, 85
NlaIII CATG 1 cut(s) 198
NmuCI GTSAC 1 cut(s) 77
Sau3AI GATC 2 cut(s) 42, 85
SetI ASST 5 cut(s) 100, 127, 142, 178, 190
SfaNI GCATC 1 cut(s) 52
SgeI CNNG 5 cut(s) 36, 58, 104, 122, 160
Sse9I AATT 3 cut(s) 127, 159, 169
SspMI CTAG 2 cut(s) 24, 189
TaaI ACNGT 1 cut(s) 49
TasI AATT 3 cut(s) 127, 159, 169
TseFI GTSAC 1 cut(s) 77
Tsp45I GTSAC 1 cut(s) 77
XapI RAATTY 1 cut(s) 169
XspI CTAG 2 cut(s) 24, 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.