MD12G1153200.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
OG0024424
Physical Location & Seq
Forward (+)
23309497 .. 23310105
609 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1153200.v1.1.491

Sequence Viewer

Length: 198 bp
ATGTGTGATGATGAGATTACACCATGTAGTAGTGGTACATGGATGGTCCTGCTTGGTATATCCTCGATGGGGGACCATACGCATTCTAGAGGAACCCGAGGTTGTGGGATTTCGTGGAGTGAAATCGTGATTCTTCATGGGGGTTTGCTATGTAGCCCTGAGTCCAGAAATTTATGTTGGTTAGGTTCTAATAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

6.99

Weight (kDa)

5.77

Isoelectric Point (pI)

50.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024424)

Species Orthologous Gene IDs
malus_domestica MD12G1153200.v1.1
pyrus_communis pycom05g23150 pycom07g07560

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 169
AfaI GTAC 1 cut(s) 37
AfiI CCNNNNNNNGG 1 cut(s) 69
AjuI GAANNNNNNNTTGG 2 cut(s) 160, 192
Ama87I CYCGRG 1 cut(s) 96
ApoI RAATTY 1 cut(s) 169
AspS9I GGNCC 2 cut(s) 46, 73
AvaI CYCGRG 1 cut(s) 96
AvaII GGWCC 2 cut(s) 46, 73
BccI CCATC 2 cut(s) 37, 61
BfaI CTAG 1 cut(s) 87
Bme18I GGWCC 2 cut(s) 46, 73
BmeT110I CYCGRG 1 cut(s) 96
BmgT120I GGNCC 2 cut(s) 46, 73
BmiI GGNNCC 2 cut(s) 74, 94
BsaJI CCNNGG 1 cut(s) 97
Bsc4I CCNNNNNNNGG 1 cut(s) 69
BseDI CCNNGG 1 cut(s) 97
BseGI GGATG 1 cut(s) 48
BseLI CCNNNNNNNGG 1 cut(s) 69
BseMII CTCAG 1 cut(s) 150
BsiHKCI CYCGRG 1 cut(s) 96
BslFI GGGAC 1 cut(s) 86
BslI CCNNNNNNNGG 1 cut(s) 69
BsmFI GGGAC 1 cut(s) 86
BsmI GAATGC 1 cut(s) 82
BsoBI CYCGRG 1 cut(s) 96
BspCNI CTCAG 1 cut(s) 151
BspLI GGNNCC 2 cut(s) 74, 94
BssECI CCNNGG 1 cut(s) 97
BstDEI CTNAG 1 cut(s) 159
BstF5I GGATG 1 cut(s) 48
BtsCI GGATG 1 cut(s) 48
Cfr13I GGNCC 2 cut(s) 46, 73
Csp6I GTAC 1 cut(s) 36
CviAII CATG 3 cut(s) 24, 39, 137
CviJI RGCY 1 cut(s) 156
CviKI_1 RGCY 1 cut(s) 156
CviQI GTAC 1 cut(s) 36
DdeI CTNAG 1 cut(s) 159
Eco47I GGWCC 2 cut(s) 46, 73
Eco88I CYCGRG 1 cut(s) 96
FaeI CATG 3 cut(s) 27, 42, 140
FaiI YATR 7 cut(s) 25, 40, 59, 78, 138, 151, 175
FaqI GGGAC 1 cut(s) 86
FatI CATG 3 cut(s) 23, 38, 136
FokI GGATG 1 cut(s) 55
FspBI CTAG 1 cut(s) 87
Hin1II CATG 3 cut(s) 27, 42, 140
HinfI GANTC 2 cut(s) 130, 161
Hpy188III TCNNGA 3 cut(s) 87, 127, 165
HpyF3I CTNAG 1 cut(s) 159
Hsp92II CATG 3 cut(s) 27, 42, 140
LpnPI CCDG 3 cut(s) 62, 171, 178
MaeI CTAG 1 cut(s) 87
MboII GAAGA 1 cut(s) 125
MluCI AATT 1 cut(s) 169
MlyI GAGTC 1 cut(s) 170
MnlI CCTC 3 cut(s) 73, 83, 92
Mva1269I GAATGC 1 cut(s) 82
NlaIII CATG 3 cut(s) 27, 42, 140
NlaIV GGNNCC 2 cut(s) 74, 94
PctI GAATGC 1 cut(s) 82
PfeI GAWTC 1 cut(s) 130
PleI GAGTC 1 cut(s) 169
PpsI GAGTC 1 cut(s) 169
PspN4I GGNNCC 2 cut(s) 74, 94
PspPI GGNCC 2 cut(s) 46, 73
RsaI GTAC 1 cut(s) 37
RsaNI GTAC 1 cut(s) 36
Sau96I GGNCC 2 cut(s) 46, 73
SchI GAGTC 1 cut(s) 170
SetI ASST 2 cut(s) 103, 187
SinI GGWCC 2 cut(s) 46, 73
Sse9I AATT 1 cut(s) 169
SspMI CTAG 1 cut(s) 87
TaqI TCGA 1 cut(s) 65
TasI AATT 1 cut(s) 169
TfiI GAWTC 1 cut(s) 130
TspDTI ATGAA 1 cut(s) 125
VpaK11BI GGWCC 2 cut(s) 46, 73
XapI RAATTY 1 cut(s) 169
XbaI TCTAGA 1 cut(s) 86
XspI CTAG 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.