MD13G1138300.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
Physical Location & Seq
Reverse (-)
10639726 .. 10641067
1342 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1138300.v1.1.491

Sequence Viewer

Length: 168 bp
ATGGAACATGGAATACATATCACCAAGTGTACTAATTCAAGATGCCATCAGATAGGCAAAATCATATCAGCTACAAAGTGCATTGAATGCTACAGGTTACTAAGTTTCGCCATATGCCTTCATTGTGGCATAGCCCTCTCTGCAACAATTTGCTTCACAAACCTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.08

Weight (kDa)

8.57

Isoelectric Point (pI)

36.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0028284)

Species Orthologous Gene IDs
malus_domestica MD13G1138300.v1.1
pyrus_communis pycom17g10670

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 27
AfaI GTAC 1 cut(s) 31
AgsI TTSAA 2 cut(s) 39, 86
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
AsuHPI GGTGA 1 cut(s) 13
BccI CCATC 1 cut(s) 54
BfmI CTRYAG 1 cut(s) 91
BmsI GCATC 1 cut(s) 32
BsmI GAATGC 1 cut(s) 92
BstAPI GCANNNNNTGC 1 cut(s) 87
BstDEI CTNAG 1 cut(s) 101
BstMWI GCNNNNNNNGC 2 cut(s) 87, 140
BstSFI CTRYAG 1 cut(s) 91
Csp6I GTAC 1 cut(s) 30
CviAII CATG 1 cut(s) 8
CviJI RGCY 2 cut(s) 71, 134
CviKI_1 RGCY 2 cut(s) 71, 134
CviQI GTAC 1 cut(s) 30
DdeI CTNAG 1 cut(s) 101
DraIII CACNNNGTG 1 cut(s) 27
FaeI CATG 1 cut(s) 11
FaiI YATR 6 cut(s) 9, 18, 65, 113, 115, 131
FatI CATG 1 cut(s) 7
FauNDI CATATG 1 cut(s) 113
FspEI CC 9 cut(s) 37, 39, 59, 79, 111, 124, 131, 148, 149
Hin1II CATG 1 cut(s) 11
HphI GGTGA 1 cut(s) 13
Hpy166II GTNNAC 1 cut(s) 30
Hpy188I TCNGA 1 cut(s) 51
Hpy188III TCNNGA 1 cut(s) 39
Hpy8I GTNNAC 1 cut(s) 30
HpyAV CCTTC 1 cut(s) 128
HpyCH4V TGCA 2 cut(s) 81, 143
HpyF10VI GCNNNNNNNGC 2 cut(s) 87, 140
HpyF3I CTNAG 1 cut(s) 101
Hsp92II CATG 1 cut(s) 11
LpnPI CCDG 1 cut(s) 79
LweI GCATC 1 cut(s) 32
MaeIII GTNAC 1 cut(s) 96
MluCI AATT 2 cut(s) 34, 147
MnlI CCTC 1 cut(s) 146
Mva1269I GAATGC 1 cut(s) 92
MwoI GCNNNNNNNGC 2 cut(s) 87, 140
NdeI CATATG 1 cut(s) 113
NlaIII CATG 1 cut(s) 11
PctI GAATGC 1 cut(s) 92
PsrI GAACNNNNNNTAC 1 cut(s) 29
RsaI GTAC 1 cut(s) 31
RsaNI GTAC 1 cut(s) 30
SetI ASST 3 cut(s) 73, 98, 165
SfaNI GCATC 1 cut(s) 32
SfcI CTRYAG 1 cut(s) 91
SgeI CNNG 4 cut(s) 20, 37, 51, 106
Sse9I AATT 2 cut(s) 34, 147
TasI AATT 2 cut(s) 34, 147
TatI WGTACW 1 cut(s) 29
TspDTI ATGAA 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.