pycom17g10670

HIT zinc finger

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Reverse (-)
8250758 .. 8251180
423 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g10670.2

Sequence Viewer

Length: 261 bp
ATGGGCACTTTTTTTGGCAATATAGTGCTTAGCTTAAAATTAGAATGTGATTCAGTTACTTGGCATCCCTTTTGTGGCCTTTTTTGTGTTAGTAGATGCCATCAGATAGGCAAAAACATATCGGCTACAAAGTGCAATGAATGCTACGGGTTACTAAGTTTTGCCATATACTTTCATTGTGGCATTGCCCTTTCTGCGACAAGTAAGCATTATAATTTCACTTTGTGGAATGATATTAAGTTGACTTATGGAATAATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.68

Weight (kDa)

8.19

Isoelectric Point (pI)

39.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0028284)

Species Orthologous Gene IDs
malus_domestica MD13G1138300.v1.1
pyrus_communis pycom17g10670

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 213
AdeI CACNNNGTG 1 cut(s) 225
AfiI CCNNNNNNNGG 1 cut(s) 74
AluBI AGCT 1 cut(s) 33
AluI AGCT 1 cut(s) 33
AoxI GGCC 1 cut(s) 76
BaeGI GKGCMC 1 cut(s) 8
BccI CCATC 1 cut(s) 108
BlpI GCTNAGC 1 cut(s) 29
BmsI GCATC 2 cut(s) 73, 86
Bpu1102I GCTNAGC 1 cut(s) 29
Bsc4I CCNNNNNNNGG 1 cut(s) 74
Bse3DI GCAATG 2 cut(s) 142, 183
BseGI GGATG 1 cut(s) 64
BseLI CCNNNNNNNGG 1 cut(s) 74
BseMI GCAATG 2 cut(s) 142, 183
BseSI GKGCMC 1 cut(s) 8
BshFI GGCC 1 cut(s) 78
BslI CCNNNNNNNGG 1 cut(s) 74
BsmI GAATGC 1 cut(s) 146
BsnI GGCC 1 cut(s) 78
Bsp1286I GDGCHC 1 cut(s) 8
Bsp1720I GCTNAGC 1 cut(s) 29
BspANI GGCC 1 cut(s) 78
BsrDI GCAATG 2 cut(s) 142, 183
BstAPI GCANNNNNTGC 1 cut(s) 141
BstDEI CTNAG 2 cut(s) 29, 155
BstF5I GGATG 1 cut(s) 64
BstMWI GCNNNNNNNGC 2 cut(s) 141, 194
BstSLI GKGCMC 1 cut(s) 8
BsuRI GGCC 1 cut(s) 78
BtsCI GGATG 1 cut(s) 64
CviJI RGCY 3 cut(s) 33, 78, 125
CviKI_1 RGCY 3 cut(s) 33, 78, 125
DdeI CTNAG 2 cut(s) 29, 155
DraIII CACNNNGTG 1 cut(s) 225
FaiI YATR 7 cut(s) 23, 119, 167, 169, 213, 249, 259
FokI GGATG 1 cut(s) 51
HaeIII GGCC 1 cut(s) 78
HincII GTYRAC 1 cut(s) 243
HindII GTYRAC 1 cut(s) 243
HinfI GANTC 1 cut(s) 50
Hpy166II GTNNAC 1 cut(s) 243
Hpy188I TCNGA 1 cut(s) 105
Hpy8I GTNNAC 1 cut(s) 243
HpyCH4V TGCA 1 cut(s) 135
HpyF10VI GCNNNNNNNGC 2 cut(s) 141, 194
HpyF3I CTNAG 2 cut(s) 29, 155
LweI GCATC 2 cut(s) 73, 86
MaeIII GTNAC 2 cut(s) 55, 150
MhlI GDGCHC 1 cut(s) 8
MluCI AATT 2 cut(s) 38, 214
MseI TTAA 2 cut(s) 35, 237
Mva1269I GAATGC 1 cut(s) 146
MwoI GCNNNNNNNGC 2 cut(s) 141, 194
PctI GAATGC 1 cut(s) 146
PfeI GAWTC 1 cut(s) 50
PsiI TTATAA 1 cut(s) 213
SaqAI TTAA 2 cut(s) 35, 237
SduI GDGCHC 1 cut(s) 8
SetI ASST 1 cut(s) 35
SfaNI GCATC 2 cut(s) 73, 86
SgeI CNNG 3 cut(s) 72, 160, 213
Sse9I AATT 2 cut(s) 38, 214
TasI AATT 2 cut(s) 38, 214
TfiI GAWTC 1 cut(s) 50
Tru1I TTAA 2 cut(s) 35, 237
Tru9I TTAA 2 cut(s) 35, 237
TspDTI ATGAA 2 cut(s) 153, 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.