MD13G1240700.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
Physical Location & Seq
Reverse (-)
24965849 .. 24967453
1605 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1240700.v1.1.491

Sequence Viewer

Length: 222 bp
ATGATGCAACCAGAGACAATTTGGGTACAAACTCAACTGCAAACGAAAAAATTGTTCAGGAGAAGTTGCTTCTTTTTTTGGATGTTACTGGCGGGTGGAAATCAGACTATTTGTTCGAAGTGTCTACCGATTAGATTTGATTGCACAAAGATAATGTTGTTGCCGTACCTATTAATTTATTGTGTCATGCAACAGTATGCTTATAGATGTATGCTTCTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.81

Weight (kDa)

9.24

Isoelectric Point (pI)

53.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024247)

Species Orthologous Gene IDs
malus_domestica MD13G1240700.v1.1 MD16G1133500.v1.1
pyrus_communis pycom13g27230

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 124
AciI CCGC 1 cut(s) 92
AfaI GTAC 2 cut(s) 27, 167
Alw26I GTCTC 1 cut(s) 8
ArsI GACNNNNNNTTYG 2 cut(s) 97, 129
AseI ATTAAT 1 cut(s) 173
AsuII TTCGAA 1 cut(s) 116
BceAI ACGGC 1 cut(s) 148
BcoDI GTCTC 1 cut(s) 8
Bpu14I TTCGAA 1 cut(s) 116
Bse1I ACTGG 1 cut(s) 93
BseGI GGATG 1 cut(s) 87
BseNI ACTGG 1 cut(s) 93
BsmAI GTCTC 1 cut(s) 8
Bsp119I TTCGAA 1 cut(s) 116
BspACI CCGC 1 cut(s) 92
BspT104I TTCGAA 1 cut(s) 116
BsrI ACTGG 1 cut(s) 93
Bst4CI ACNGT 1 cut(s) 195
BstBI TTCGAA 1 cut(s) 116
BstF5I GGATG 1 cut(s) 87
BstMAI GTCTC 1 cut(s) 8
BtsCI GGATG 1 cut(s) 87
Csp6I GTAC 2 cut(s) 26, 166
CviAII CATG 1 cut(s) 187
CviQI GTAC 2 cut(s) 26, 166
FaeI CATG 1 cut(s) 190
FaiI YATR 5 cut(s) 188, 198, 204, 212, 220
FatI CATG 1 cut(s) 186
FauI CCCGC 1 cut(s) 85
FblI GTMKAC 1 cut(s) 124
FokI GGATG 1 cut(s) 94
Hin1II CATG 1 cut(s) 190
Hpy166II GTNNAC 1 cut(s) 125
Hpy188I TCNGA 1 cut(s) 105
Hpy188III TCNNGA 1 cut(s) 58
Hpy8I GTNNAC 1 cut(s) 125
HpyCH4III ACNGT 1 cut(s) 195
HpyCH4V TGCA 4 cut(s) 7, 40, 144, 190
Hsp92II CATG 1 cut(s) 190
LpnPI CCDG 3 cut(s) 24, 43, 74
MaeIII GTNAC 1 cut(s) 84
MluCI AATT 3 cut(s) 18, 50, 174
MseI TTAA 1 cut(s) 173
NlaIII CATG 1 cut(s) 190
NspV TTCGAA 1 cut(s) 116
PshBI ATTAAT 1 cut(s) 173
RsaI GTAC 2 cut(s) 27, 167
RsaNI GTAC 2 cut(s) 26, 166
SaqAI TTAA 1 cut(s) 173
SetI ASST 1 cut(s) 171
SfuI TTCGAA 1 cut(s) 116
SgeI CNNG 5 cut(s) 23, 70, 101, 105, 199
Sse9I AATT 3 cut(s) 18, 50, 174
SsiI CCGC 1 cut(s) 92
TaaI ACNGT 1 cut(s) 195
TaqI TCGA 1 cut(s) 116
TasI AATT 3 cut(s) 18, 50, 174
Tru1I TTAA 1 cut(s) 173
Tru9I TTAA 1 cut(s) 173
VspI ATTAAT 1 cut(s) 173
XcmI CCANNNNNNNNNTGG 1 cut(s) 18
XmiI GTMKAC 1 cut(s) 124
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.