Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr13

Orthogroup ID

OG0024246

Physical Location & Seq

Genomic Coordinates Forward (+)

35966601 .. 35968238

Gene Structure 1638 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD13G1270400.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 234 bp

ATGTTCGCAACACCAATTGAAGGTTCATCTGTAGTGTTCTGTTTGGATGGGGCTGATTTACCCAAAGACGATTTCTACCAGTGCTATATGATTGTTGTTCAAGGTGCAAAAAATGTCATCAGTGCTTGTCGGGCGTGCAAAGTTAGGCAGTTAATATACAATAGTTCTGCTGGTGTAGTTTTTGATGCTTCAAAAGATATATTAAATGGAGAAGAATCTTTGGCATATCCTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005623 GO:0005886 GO:0005911 GO:0009506 GO:0016020 GO:0030054 GO:0044464 GO:0055044 GO:0071944

KEGG Pathways

Metabolic & Signaling

ko00100 ko01100 ko01130 map00100 map01100 map01130

Pfam Domains

Protein Families

3Beta_HSD Reticulon

Protein Analysis

78

Amino Acids

8.34

Weight (kDa)

4.52

Isoelectric Point (pI)

51.48

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
3Beta_HSD	PF01073	6 - 76	4.5e-15	3-beta hydroxysteroid dehydrogenase/isomerase family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024246)

Species	Orthologous Gene IDs
malus_domestica	MD13G1270400.v1.1
pyrus_communis	pycom13g27470 pycom849g00020

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfiI	CCNNNNNNNGG	1 cut(s)	20
AgsI	TTSAA	3 cut(s)	20, 101, 192
AjuI	GAANNNNNNNTTGG	4 cut(s)	7, 39, 56, 88
BccI	CCATC	1 cut(s)	41
BfmI	CTRYAG	1 cut(s)	30
BmsI	GCATC	1 cut(s)	175
Bsc4I	CCNNNNNNNGG	1 cut(s)	20
Bse1I	ACTGG	1 cut(s)	79
BseGI	GGATG	1 cut(s)	52
BseLI	CCNNNNNNNGG	1 cut(s)	20
BseNI	ACTGG	1 cut(s)	79
BslI	CCNNNNNNNGG	1 cut(s)	20
BsrI	ACTGG	1 cut(s)	79
BstC8I	GCNNGC	1 cut(s)	136
BstF5I	GGATG	1 cut(s)	52
BstMWI	GCNNNNNNNGC	1 cut(s)	131
BstSFI	CTRYAG	1 cut(s)	30
BtsCI	GGATG	1 cut(s)	52
BtsIMutI	CAGTG	2 cut(s)	86, 127
Cac8I	GCNNGC	1 cut(s)	136
CviJI	RGCY	1 cut(s)	53
CviKI_1	RGCY	1 cut(s)	53
FaiI	YATR	5 cut(s)	87, 89, 157, 200, 226
FokI	GGATG	1 cut(s)	59
HinfI	GANTC	1 cut(s)	215
HpyAV	CCTTC	1 cut(s)	14
HpyCH4V	TGCA	2 cut(s)	107, 138
HpyF10VI	GCNNNNNNNGC	1 cut(s)	131
LpnPI	CCDG	2 cut(s)	92, 156
LweI	GCATC	1 cut(s)	175
MboII	GAAGA	1 cut(s)	224
MfeI	CAATTG	1 cut(s)	15
MluCI	AATT	1 cut(s)	15
MseI	TTAA	2 cut(s)	152, 203
MunI	CAATTG	1 cut(s)	15
MwoI	GCNNNNNNNGC	1 cut(s)	131
PfeI	GAWTC	1 cut(s)	215
SaqAI	TTAA	2 cut(s)	152, 203
SetI	ASST	2 cut(s)	25, 106
SfaNI	GCATC	1 cut(s)	175
SfcI	CTRYAG	1 cut(s)	30
SgeI	CNNG	6 cut(s)	91, 113, 138, 143, 147, 183
Sse9I	AATT	1 cut(s)	15
TasI	AATT	1 cut(s)	15
TfiI	GAWTC	1 cut(s)	215
Tru1I	TTAA	2 cut(s)	152, 203
Tru9I	TTAA	2 cut(s)	152, 203
TscAI	CASTG	2 cut(s)	86, 127
TspDTI	ATGAA	1 cut(s)	15
TspRI	CASTG	2 cut(s)	86, 127

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.