MD13G1271800.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
OG0022308
Physical Location & Seq
Reverse (-)
36425774 .. 36434847
9074 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1271800.v1.1.491

Sequence Viewer

Length: 189 bp
ATGCATTTTGGAGCATTTTGGAGCAAAATGGAGCTTGGAATGCATGTCACATATTTGGGCCAAAGTGGATGGACGAATTTGAGAACTAAAGAGGCCAAGAATGTGAAGAATTATGGTCCAAAAGATGAAGAACTCAGCCCAAAAATTTGTCACCCCAACTTGCCTTCATTGCCATGCAAAACAACATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.05

Weight (kDa)

9.06

Isoelectric Point (pI)

58.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022308)

Species Orthologous Gene IDs
malus_domestica MD08G1138300.v1.1 MD13G1271800.v1.1 MD13G1274300.v1.1
pyrus_communis pycom12420g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 76, 144
AluBI AGCT 1 cut(s) 34
AluI AGCT 1 cut(s) 34
AoxI GGCC 2 cut(s) 58, 93
ApoI RAATTY 2 cut(s) 76, 144
AspS9I GGNCC 2 cut(s) 58, 116
AsuHPI GGTGA 1 cut(s) 143
AvaII GGWCC 1 cut(s) 116
BccI CCATC 1 cut(s) 63
Bme18I GGWCC 1 cut(s) 116
BmgT120I GGNCC 2 cut(s) 58, 116
Bse3DI GCAATG 1 cut(s) 167
BseGI GGATG 1 cut(s) 74
BseMI GCAATG 1 cut(s) 167
BseMII CTCAG 1 cut(s) 148
BshFI GGCC 2 cut(s) 60, 95
BsmI GAATGC 1 cut(s) 45
BsnI GGCC 2 cut(s) 60, 95
BspANI GGCC 2 cut(s) 60, 95
BspCNI CTCAG 1 cut(s) 147
BsrDI GCAATG 1 cut(s) 167
BstDEI CTNAG 1 cut(s) 134
BstF5I GGATG 1 cut(s) 74
BstMWI GCNNNNNNNGC 2 cut(s) 40, 169
BstNSI RCATGY 1 cut(s) 47
BsuRI GGCC 2 cut(s) 60, 95
BtsCI GGATG 1 cut(s) 74
Cfr13I GGNCC 2 cut(s) 58, 116
CviAII CATG 2 cut(s) 44, 174
CviJI RGCY 4 cut(s) 34, 60, 95, 138
CviKI_1 RGCY 4 cut(s) 34, 60, 95, 138
DdeI CTNAG 1 cut(s) 134
Eco47I GGWCC 1 cut(s) 116
EcoT22I ATGCAT 2 cut(s) 6, 45
FaeI CATG 2 cut(s) 47, 177
FaiI YATR 5 cut(s) 45, 52, 114, 175, 187
FatI CATG 2 cut(s) 43, 173
FokI GGATG 1 cut(s) 81
HaeIII GGCC 2 cut(s) 60, 95
Hin1II CATG 2 cut(s) 47, 177
HphI GGTGA 1 cut(s) 143
HpyAV CCTTC 1 cut(s) 174
HpyCH4V TGCA 3 cut(s) 4, 43, 177
HpyF10VI GCNNNNNNNGC 2 cut(s) 40, 169
HpyF3I CTNAG 1 cut(s) 134
Hsp92II CATG 2 cut(s) 47, 177
LmnI GCTCC 3 cut(s) 11, 21, 31
MaeIII GTNAC 2 cut(s) 46, 149
MboII GAAGA 2 cut(s) 118, 140
MluCI AATT 3 cut(s) 76, 109, 144
MnlI CCTC 1 cut(s) 85
Mph1103I ATGCAT 2 cut(s) 6, 45
MslI CAYNNNNRTG 1 cut(s) 172
Mva1269I GAATGC 1 cut(s) 45
MwoI GCNNNNNNNGC 2 cut(s) 40, 169
NlaIII CATG 2 cut(s) 47, 177
NmuCI GTSAC 2 cut(s) 46, 149
NsiI ATGCAT 2 cut(s) 6, 45
NspI RCATGY 1 cut(s) 47
PctI GAATGC 1 cut(s) 45
PspPI GGNCC 2 cut(s) 58, 116
RseI CAYNNNNRTG 1 cut(s) 172
Sau96I GGNCC 2 cut(s) 58, 116
SetI ASST 1 cut(s) 36
SgeI CNNG 4 cut(s) 47, 56, 109, 172
SinI GGWCC 1 cut(s) 116
SmiMI CAYNNNNRTG 1 cut(s) 172
Sse9I AATT 3 cut(s) 76, 109, 144
TasI AATT 3 cut(s) 76, 109, 144
TseFI GTSAC 2 cut(s) 46, 149
Tsp45I GTSAC 2 cut(s) 46, 149
TspDTI ATGAA 2 cut(s) 141, 156
VpaK11BI GGWCC 1 cut(s) 116
XapI RAATTY 2 cut(s) 76, 144
XceI RCATGY 1 cut(s) 47
Zsp2I ATGCAT 2 cut(s) 6, 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.