MD13G1274300.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
OG0022308
Physical Location & Seq
Forward (+)
37271109 .. 37273823
2715 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1274300.v1.1.491

Sequence Viewer

Length: 195 bp
ATGCATGGGCCAAGTGGATGGACGAATTTGAGAACTAAAGAGGCCAAGAATATGAAGAATTATGGTCCAAAAGATGAAGAAAACAACCCAAAAATCTGTCACCCCAACTTGCATTCCTTGCCATGCAAACCACATAGAATTCCCTTTGGATTCCATGCCATGCTTGATCACTCTTGTCCCCTACATAATTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.37

Weight (kDa)

8.96

Isoelectric Point (pI)

39.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022308)

Species Orthologous Gene IDs
malus_domestica MD08G1138300.v1.1 MD13G1271800.v1.1 MD13G1274300.v1.1
pyrus_communis pycom12420g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 25, 138
AoxI GGCC 2 cut(s) 8, 42
ApoI RAATTY 2 cut(s) 25, 138
AspS9I GGNCC 2 cut(s) 8, 65
AsuHPI GGTGA 1 cut(s) 92
AvaII GGWCC 1 cut(s) 65
BccI CCATC 1 cut(s) 12
BclI TGATCA 1 cut(s) 166
Bme18I GGWCC 1 cut(s) 65
BmgT120I GGNCC 2 cut(s) 8, 65
BseGI GGATG 1 cut(s) 23
BshFI GGCC 2 cut(s) 10, 44
BslFI GGGAC 1 cut(s) 162
BsmFI GGGAC 1 cut(s) 162
BsmI GAATGC 1 cut(s) 112
BsnI GGCC 2 cut(s) 10, 44
Bsp143I GATC 1 cut(s) 166
BspANI GGCC 2 cut(s) 10, 44
BssMI GATC 1 cut(s) 166
BstAPI GCANNNNNTGC 1 cut(s) 118
BstF5I GGATG 1 cut(s) 23
BstKTI GATC 1 cut(s) 169
BstMBI GATC 1 cut(s) 166
BstMWI GCNNNNNNNGC 1 cut(s) 118
BstXI CCANNNNNNTGG 1 cut(s) 18
BsuRI GGCC 2 cut(s) 10, 44
BtsCI GGATG 1 cut(s) 23
Cfr13I GGNCC 2 cut(s) 8, 65
CviAII CATG 4 cut(s) 5, 123, 155, 160
CviJI RGCY 2 cut(s) 10, 44
CviKI_1 RGCY 2 cut(s) 10, 44
DpnI GATC 1 cut(s) 168
DpnII GATC 1 cut(s) 166
Eco47I GGWCC 1 cut(s) 65
EcoRI GAATTC 1 cut(s) 138
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 4 cut(s) 8, 126, 158, 163
FaiI YATR 8 cut(s) 6, 53, 63, 124, 135, 156, 161, 186
FaqI GGGAC 1 cut(s) 162
FatI CATG 4 cut(s) 4, 122, 154, 159
FbaI TGATCA 1 cut(s) 166
FokI GGATG 1 cut(s) 30
HaeIII GGCC 2 cut(s) 10, 44
Hin1II CATG 4 cut(s) 8, 126, 158, 163
HinfI GANTC 1 cut(s) 150
HphI GGTGA 1 cut(s) 92
HpyCH4V TGCA 3 cut(s) 4, 112, 126
HpyF10VI GCNNNNNNNGC 1 cut(s) 118
Hsp92II CATG 4 cut(s) 8, 126, 158, 163
Ksp22I TGATCA 1 cut(s) 166
Kzo9I GATC 1 cut(s) 166
MaeIII GTNAC 1 cut(s) 98
MalI GATC 1 cut(s) 168
MboI GATC 1 cut(s) 166
MboII GAAGA 2 cut(s) 67, 89
MluCI AATT 4 cut(s) 25, 58, 138, 187
MnlI CCTC 1 cut(s) 34
Mph1103I ATGCAT 1 cut(s) 6
Mva1269I GAATGC 1 cut(s) 112
MwoI GCNNNNNNNGC 1 cut(s) 118
NdeII GATC 1 cut(s) 166
NlaIII CATG 4 cut(s) 8, 126, 158, 163
NmuCI GTSAC 1 cut(s) 98
NsiI ATGCAT 1 cut(s) 6
PctI GAATGC 1 cut(s) 112
PfeI GAWTC 1 cut(s) 150
PspPI GGNCC 2 cut(s) 8, 65
Sau3AI GATC 1 cut(s) 166
Sau96I GGNCC 2 cut(s) 8, 65
SinI GGWCC 1 cut(s) 65
Sse9I AATT 4 cut(s) 25, 58, 138, 187
TasI AATT 4 cut(s) 25, 58, 138, 187
TfiI GAWTC 1 cut(s) 150
TseFI GTSAC 1 cut(s) 98
Tsp45I GTSAC 1 cut(s) 98
TspDTI ATGAA 2 cut(s) 68, 90
VpaK11BI GGWCC 1 cut(s) 65
XapI RAATTY 2 cut(s) 25, 138
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.