Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr16

Orthogroup ID

OG0028521

Physical Location & Seq

Genomic Coordinates Forward (+)

1988237 .. 1988525

Gene Structure 289 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD16G1028100.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 183 bp

ATGCAGATTGGAGAATTGGCATTAATTGCTGTAGGAATGACAATAACTATCGACGTCCTCGTTGCCAGACCGGTCTTAGGGGCATCGATGGACCCAGCACGGAGCCAAGGGCCAACAATAGTGATGCACACAGACAAGGGAATATCGATTTATATTGTAGGTCCATTCGTTGGCACCATATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005215 GO:0005372 GO:0005575 GO:0005623 GO:0005886 GO:0005887 GO:0006810 GO:0006811 GO:0006833 GO:0008150 GO:0015250 GO:0015267 GO:0015318 GO:0016020 GO:0016021 GO:0022803 GO:0022838 GO:0022857 GO:0031224 GO:0031226 GO:0034220 GO:0042044 GO:0044425 GO:0044459 GO:0044464 GO:0051179 GO:0051234 GO:0055085 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

MIP

Protein Analysis

61

Amino Acids

6.24

Weight (kDa)

5.41

Isoelectric Point (pI)

24.35

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
MIP	PF00230	3 - 60	9.1e-13	Major intrinsic protein

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0028521)

Species	Orthologous Gene IDs
malus_domestica	MD16G1028100.v1.1
pyrus_communis	pycom16g02400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	57
AccB1I	GGYRCC	1 cut(s)	173
AccB7I	CCANNNNNTGG	1 cut(s)	170
AcyI	GRCGYC	1 cut(s)	54
AfiI	CCNNNNNNNGG	2 cut(s)	77, 170
AgeI	ACCGGT	1 cut(s)	70
AoxI	GGCC	1 cut(s)	110
AseI	ATTAAT	1 cut(s)	23
AsiGI	ACCGGT	1 cut(s)	70
AspS9I	GGNCC	3 cut(s)	91, 110, 161
AvaII	GGWCC	2 cut(s)	91, 161
BanI	GGYRCC	1 cut(s)	173
BccI	CCATC	1 cut(s)	82
BfmI	CTRYAG	1 cut(s)	30
Bme18I	GGWCC	2 cut(s)	91, 161
BmgT120I	GGNCC	3 cut(s)	91, 110, 161
BmiI	GGNNCC	3 cut(s)	93, 104, 175
BmsI	GCATC	2 cut(s)	92, 114
Bsa29I	ATCGAT	2 cut(s)	86, 146
BsaHI	GRCGYC	1 cut(s)	54
BsaJI	CCNNGG	1 cut(s)	106
BsaWI	WCCGGW	1 cut(s)	70
Bsc4I	CCNNNNNNNGG	2 cut(s)	77, 170
Bse118I	RCCGGY	1 cut(s)	70
BseCI	ATCGAT	2 cut(s)	86, 146
BseDI	CCNNGG	1 cut(s)	106
BseLI	CCNNNNNNNGG	2 cut(s)	77, 170
BseYI	CCCAGC	1 cut(s)	94
BshFI	GGCC	1 cut(s)	112
BshNI	GGYRCC	1 cut(s)	173
BshTI	ACCGGT	1 cut(s)	70
BshVI	ATCGAT	2 cut(s)	86, 146
BsiSI	CCGG	1 cut(s)	71
BslI	CCNNNNNNNGG	2 cut(s)	77, 170
BsnI	GGCC	1 cut(s)	112
BspANI	GGCC	1 cut(s)	112
BspDI	ATCGAT	2 cut(s)	86, 146
BspLI	GGNNCC	3 cut(s)	93, 104, 175
BspT107I	GGYRCC	1 cut(s)	173
BsrFI	RCCGGY	1 cut(s)	70
BssAI	RCCGGY	1 cut(s)	70
BssECI	CCNNGG	1 cut(s)	106
BssNI	GRCGYC	1 cut(s)	54
BssT1I	CCWWGG	1 cut(s)	106
BstACI	GRCGYC	1 cut(s)	54
BstAPI	GCANNNNNTGC	1 cut(s)	26
BstDEI	CTNAG	1 cut(s)	76
BstMWI	GCNNNNNNNGC	1 cut(s)	26
BstSFI	CTRYAG	1 cut(s)	30
Bsu15I	ATCGAT	2 cut(s)	86, 146
BsuRI	GGCC	1 cut(s)	112
BsuTUI	ATCGAT	2 cut(s)	86, 146
Cfr10I	RCCGGY	1 cut(s)	70
Cfr13I	GGNCC	3 cut(s)	91, 110, 161
ClaI	ATCGAT	2 cut(s)	86, 146
CspAI	ACCGGT	1 cut(s)	70
CviJI	RGCY	2 cut(s)	105, 112
CviKI_1	RGCY	2 cut(s)	105, 112
DdeI	CTNAG	1 cut(s)	76
Eco130I	CCWWGG	1 cut(s)	106
Eco47I	GGWCC	2 cut(s)	91, 161
EcoT14I	CCWWGG	1 cut(s)	106
ErhI	CCWWGG	1 cut(s)	106
FaiI	YATR	3 cut(s)	153, 179, 181
GsaI	CCCAGC	1 cut(s)	98
HaeIII	GGCC	1 cut(s)	112
HapII	CCGG	1 cut(s)	71
Hin1I	GRCGYC	1 cut(s)	54
HpaII	CCGG	1 cut(s)	71
Hpy99I	CGWCG	1 cut(s)	56
HpyCH4IV	ACGT	1 cut(s)	54
HpyCH4V	TGCA	2 cut(s)	4, 127
HpyF10VI	GCNNNNNNNGC	1 cut(s)	26
HpyF3I	CTNAG	1 cut(s)	76
HpySE526I	ACGT	1 cut(s)	54
Hsp92I	GRCGYC	1 cut(s)	54
LmnI	GCTCC	1 cut(s)	102
LpnPI	CCDG	3 cut(s)	79, 84, 108
LweI	GCATC	2 cut(s)	92, 114
MaeII	ACGT	1 cut(s)	54
MluCI	AATT	2 cut(s)	14, 24
MnlI	CCTC	1 cut(s)	68
MseI	TTAA	1 cut(s)	23
MspI	CCGG	1 cut(s)	71
MwoI	GCNNNNNNNGC	1 cut(s)	26
NlaIV	GGNNCC	3 cut(s)	93, 104, 175
PcsI	WCGNNNNNNNCGW	1 cut(s)	57
PflMI	CCANNNNNTGG	1 cut(s)	170
PinAI	ACCGGT	1 cut(s)	70
PshBI	ATTAAT	1 cut(s)	23
PspFI	CCCAGC	1 cut(s)	94
PspN4I	GGNNCC	3 cut(s)	93, 104, 175
PspPI	GGNCC	3 cut(s)	91, 110, 161
SaqAI	TTAA	1 cut(s)	23
Sau96I	GGNCC	3 cut(s)	91, 110, 161
SetI	ASST	2 cut(s)	57, 163
SfaNI	GCATC	2 cut(s)	92, 114
SfcI	CTRYAG	1 cut(s)	30
SgeI	CNNG	7 cut(s)	71, 78, 83, 107, 111, 119, 148
SinI	GGWCC	2 cut(s)	91, 161
Sse9I	AATT	2 cut(s)	14, 24
StyI	CCWWGG	1 cut(s)	106
TaiI	ACGT	1 cut(s)	57
TaqI	TCGA	3 cut(s)	51, 86, 146
TasI	AATT	2 cut(s)	14, 24
Tru1I	TTAA	1 cut(s)	23
Tru9I	TTAA	1 cut(s)	23
TspGWI	ACGGA	1 cut(s)	115
Van91I	CCANNNNNTGG	1 cut(s)	170
VpaK11BI	GGWCC	2 cut(s)	91, 161
VspI	ATTAAT	1 cut(s)	23
ZraI	GACGTC	1 cut(s)	55

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.