MD16G1175100.v1.1

serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
Physical Location & Seq
Forward (+)
14872405 .. 14872639
235 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1175100.v1.1.491

Sequence Viewer

Length: 159 bp
ATGAACCAAGTATTATCAGGACTGGAACACTGTCACAACCACAATGTGCTTCATCGTGATATCAAAGGGTCCAATCTTCTTATCGACAATGGTGGTGTCCTAAAGATTGCTGATTTTGGACTGGCTTCTTCTATGACCCAAATCACAAGCATCCAATGA

Protein Analysis

53

Amino Acids

5.64

Weight (kDa)

6.37

Isoelectric Point (pI)

12.4

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pkinase PF00069 1 - 47 2.1e-18 Protein kinase domain
PK_Tyr_Ser-Thr PF07714 2 - 46 1.1e-10 Protein tyrosine and serine/threonine kinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024356)

Species Orthologous Gene IDs
malus_domestica MD16G1175100.v1.1
rosa_chinensis RchiOBHm_Chr2g0113391
rosa_roxburghii Rroxscaffold_2G00125160

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 46
AspS9I GGNCC 1 cut(s) 69
AvaII GGWCC 1 cut(s) 69
Bme18I GGWCC 1 cut(s) 69
BmgT120I GGNCC 1 cut(s) 69
BmiI GGNNCC 1 cut(s) 70
Bse1I ACTGG 2 cut(s) 27, 126
BseGI GGATG 1 cut(s) 150
BseNI ACTGG 2 cut(s) 27, 126
BspLI GGNNCC 1 cut(s) 70
BsrI ACTGG 2 cut(s) 27, 126
Bst4CI ACNGT 1 cut(s) 32
BstF5I GGATG 1 cut(s) 150
BtsCI GGATG 1 cut(s) 150
BtsIMutI CAGTG 1 cut(s) 28
Cfr13I GGNCC 1 cut(s) 69
CviJI RGCY 1 cut(s) 125
CviKI_1 RGCY 1 cut(s) 125
DraIII CACNNNGTG 1 cut(s) 46
Eco32I GATATC 1 cut(s) 61
Eco47I GGWCC 1 cut(s) 69
EcoRV GATATC 1 cut(s) 61
FaiI YATR 1 cut(s) 134
FokI GGATG 1 cut(s) 137
Hpy188III TCNNGA 2 cut(s) 18, 56
HpyCH4III ACNGT 1 cut(s) 32
LpnPI CCDG 3 cut(s) 3, 8, 107
MaeIII GTNAC 1 cut(s) 32
MboII GAAGA 2 cut(s) 68, 120
NlaIV GGNNCC 1 cut(s) 70
NmuCI GTSAC 1 cut(s) 32
PspN4I GGNNCC 1 cut(s) 70
PspPI GGNCC 1 cut(s) 69
Sau96I GGNCC 1 cut(s) 69
SgeI CNNG 5 cut(s) 20, 30, 35, 68, 134
SinI GGWCC 1 cut(s) 69
TaaI ACNGT 1 cut(s) 32
TaqI TCGA 1 cut(s) 84
TscAI CASTG 1 cut(s) 35
TseFI GTSAC 1 cut(s) 32
Tsp45I GTSAC 1 cut(s) 32
TspDTI ATGAA 2 cut(s) 17, 41
TspRI CASTG 1 cut(s) 35
VpaK11BI GGWCC 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.