MD17G1243100.v1.1

Clathrin light chain

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Reverse (-)
29197990 .. 29199684
1695 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1243100.v1.1.491

Sequence Viewer

Length: 156 bp
ATGCGGAACCAAATTATCGAGGAAGCTGAAGAATTTAAGCGGGCCTTCTATGAGAAACGGAAGCTCAATTGTGAAACTAACAAAGCTCACAACAGAGAGAGGGAGAAGCTGTACCTGGCCAACCAAGAGAAGTTCCACAAAGAAGCTGACAAATGA

Protein Analysis

52

Amino Acids

6.36

Weight (kDa)

8.82

Isoelectric Point (pI)

49.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024434)

Species Orthologous Gene IDs
malus_domestica MD17G1243100.v1.1
rosa_chinensis RchiOBHm_Chr1g0369891
rosa_samantha Rh1AG361600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 4, 40
AcoI YGGCCR 1 cut(s) 117
AcsI RAATTY 1 cut(s) 32
AcuI CTGAAG 1 cut(s) 48
AfaI GTAC 1 cut(s) 113
AjnI CCWGG 1 cut(s) 114
AluBI AGCT 5 cut(s) 26, 64, 86, 109, 146
AluI AGCT 5 cut(s) 26, 64, 86, 109, 146
AoxI GGCC 2 cut(s) 42, 117
ApoI RAATTY 1 cut(s) 32
AspS9I GGNCC 1 cut(s) 42
BalI TGGCCA 1 cut(s) 119
BciT130I CCWGG 1 cut(s) 116
Bme1390I CCNGG 1 cut(s) 116
BmgT120I GGNCC 1 cut(s) 42
BmiI GGNNCC 1 cut(s) 8
BmrFI CCNGG 1 cut(s) 116
BsaXI ACNNNNNCTCC 2 cut(s) 95, 125
BseBI CCWGG 1 cut(s) 116
BshFI GGCC 2 cut(s) 44, 119
BsnI GGCC 2 cut(s) 44, 119
BspACI CCGC 2 cut(s) 4, 40
BspANI GGCC 2 cut(s) 44, 119
BspLI GGNNCC 1 cut(s) 8
Bst2UI CCWGG 1 cut(s) 116
BstC8I GCNNGC 1 cut(s) 42
BstNI CCWGG 1 cut(s) 116
BstSCI CCNGG 1 cut(s) 114
BsuRI GGCC 2 cut(s) 44, 119
Cac8I GCNNGC 1 cut(s) 42
Cfr13I GGNCC 1 cut(s) 42
Csp6I GTAC 1 cut(s) 112
CviJI RGCY 7 cut(s) 26, 44, 64, 86, 109, 119, 146
CviKI_1 RGCY 7 cut(s) 26, 44, 64, 86, 109, 119, 146
CviQI GTAC 1 cut(s) 112
EaeI YGGCCR 1 cut(s) 117
Eco57I CTGAAG 1 cut(s) 48
EcoRII CCWGG 1 cut(s) 114
FaiI YATR 1 cut(s) 51
FalI AAGNNNNNCTT 2 cut(s) 29, 61
FauI CCCGC 1 cut(s) 33
HaeIII GGCC 2 cut(s) 44, 119
HpyAV CCTTC 1 cut(s) 55
LpnPI CCDG 2 cut(s) 101, 128
MboII GAAGA 1 cut(s) 41
MfeI CAATTG 1 cut(s) 67
MlsI TGGCCA 1 cut(s) 119
MluCI AATT 3 cut(s) 12, 32, 67
MluNI TGGCCA 1 cut(s) 119
MnlI CCTC 2 cut(s) 13, 93
Mox20I TGGCCA 1 cut(s) 119
MscI TGGCCA 1 cut(s) 119
MseI TTAA 1 cut(s) 36
Msp20I TGGCCA 1 cut(s) 119
MspR9I CCNGG 1 cut(s) 116
MunI CAATTG 1 cut(s) 67
MvaI CCWGG 1 cut(s) 116
NlaIV GGNNCC 1 cut(s) 8
Psp6I CCWGG 1 cut(s) 114
PspGI CCWGG 1 cut(s) 114
PspN4I GGNNCC 1 cut(s) 8
PspPI GGNCC 1 cut(s) 42
RsaI GTAC 1 cut(s) 113
RsaNI GTAC 1 cut(s) 112
SaqAI TTAA 1 cut(s) 36
Sau96I GGNCC 1 cut(s) 42
ScrFI CCNGG 1 cut(s) 116
SetI ASST 6 cut(s) 28, 66, 88, 111, 117, 148
SgeI CNNG 5 cut(s) 31, 53, 127, 128, 137
Sse9I AATT 3 cut(s) 12, 32, 67
SsiI CCGC 2 cut(s) 4, 40
StyD4I CCNGG 1 cut(s) 114
TaqI TCGA 1 cut(s) 18
TasI AATT 3 cut(s) 12, 32, 67
Tru1I TTAA 1 cut(s) 36
Tru9I TTAA 1 cut(s) 36
TspGWI ACGGA 1 cut(s) 73
XapI RAATTY 1 cut(s) 32
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.