Prupe.1G196800_v2.0.a1

Glutathione S-transferase T3-like

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Reverse (-)
18773756 .. 18774175
420 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G196800.1

Sequence Viewer

Length: 420 bp
ATGACCACAGAGAATACCAGCGATGCAGACCCTAGCGATACCTTTTCAACGCATGGCTACATGTCGGTTGATAAATCTTCCAATGAATCTCTTCTATCATCTCAAAATCCTGCTCAAATAGAATCCATCAAAATGGAACAAAGATCTCGTAACTTCTCAATCGATGAAGACAATCAGCTTGTGTCTGTTTGGCTCAATGTTTGCTTAGATGCAGATAATGGAGATGAGCAAAAAAGTAGTGGGTATTGGAAAAGAATATGGGAGTATTTCAACAAGGGAAAGAAATTTACTTTTGAGCGTTTTGCTGATTCTCTAATGGACTGTTGCTCAGCCATGCAATTTGCAGTGCATTATTTTTGTGGGTACTATGCCCAGATTAAAGCAATGAAACAAAGTGGTGTCAACGACCAAATAGGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

140

Amino Acids

15.87

Weight (kDa)

4.7

Isoelectric Point (pI)

48.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0026653)

Species Orthologous Gene IDs
prunus_persica Prupe.1G196800_v2.0.a1
rosa_laevigata RLG00000012679

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 284
AfaI GTAC 1 cut(s) 365
AflIII ACRYGT 1 cut(s) 60
AgsI TTSAA 2 cut(s) 48, 271
AluBI AGCT 1 cut(s) 178
AluI AGCT 1 cut(s) 178
ApoI RAATTY 1 cut(s) 284
Asp700I GAANNNNTTC 1 cut(s) 90
BbsI GAAGAC 1 cut(s) 174
BccI CCATC 1 cut(s) 134
BfaI CTAG 1 cut(s) 33
BglII AGATCT 1 cut(s) 143
BlpI GCTNAGC 1 cut(s) 328
BmsI GCATC 2 cut(s) 13, 199
BpiI GAAGAC 1 cut(s) 174
Bpu1102I GCTNAGC 1 cut(s) 328
Bsa29I ATCGAT 1 cut(s) 162
Bse3DI GCAATG 1 cut(s) 390
BseCI ATCGAT 1 cut(s) 162
BseMI GCAATG 1 cut(s) 390
BseMII CTCAG 1 cut(s) 342
BshVI ATCGAT 1 cut(s) 162
Bsp143I GATC 1 cut(s) 143
Bsp1720I GCTNAGC 1 cut(s) 328
BspCNI CTCAG 1 cut(s) 341
BspDI ATCGAT 1 cut(s) 162
BsrDI GCAATG 1 cut(s) 390
BssMI GATC 1 cut(s) 143
Bst4CI ACNGT 1 cut(s) 323
Bst6I CTCTTC 1 cut(s) 96
BstDEI CTNAG 2 cut(s) 205, 328
BstKTI GATC 1 cut(s) 146
BstMBI GATC 1 cut(s) 143
BstNSI RCATGY 1 cut(s) 64
BstV2I GAAGAC 1 cut(s) 174
BstX2I RGATCY 1 cut(s) 143
BstXI CCANNNNNNTGG 1 cut(s) 133
BstYI RGATCY 1 cut(s) 143
Bsu15I ATCGAT 1 cut(s) 162
BsuTUI ATCGAT 1 cut(s) 162
BtgZI GCGATG 1 cut(s) 36
BtsI GCAGTG 1 cut(s) 351
BtsIMutI CAGTG 1 cut(s) 351
ClaI ATCGAT 1 cut(s) 162
Csp6I GTAC 1 cut(s) 364
CviAII CATG 3 cut(s) 53, 61, 334
CviJI RGCY 4 cut(s) 57, 178, 193, 332
CviKI_1 RGCY 4 cut(s) 57, 178, 193, 332
CviQI GTAC 1 cut(s) 364
DdeI CTNAG 2 cut(s) 205, 328
DpnI GATC 1 cut(s) 145
DpnII GATC 1 cut(s) 143
Eam1104I CTCTTC 1 cut(s) 96
EarI CTCTTC 1 cut(s) 96
FaeI CATG 3 cut(s) 56, 64, 337
FaiI YATR 5 cut(s) 54, 62, 259, 335, 369
FatI CATG 3 cut(s) 52, 60, 333
FspBI CTAG 1 cut(s) 33
Hin1II CATG 3 cut(s) 56, 64, 337
HincII GTYRAC 1 cut(s) 403
HindII GTYRAC 1 cut(s) 403
HinfI GANTC 3 cut(s) 86, 122, 308
Hpy166II GTNNAC 1 cut(s) 403
Hpy8I GTNNAC 1 cut(s) 403
HpyCH4III ACNGT 1 cut(s) 323
HpyCH4V TGCA 5 cut(s) 26, 212, 337, 344, 349
HpyF3I CTNAG 2 cut(s) 205, 328
Hsp92II CATG 3 cut(s) 56, 64, 337
Kzo9I GATC 1 cut(s) 143
LpnPI CCDG 3 cut(s) 31, 123, 386
LweI GCATC 2 cut(s) 13, 199
MaeI CTAG 1 cut(s) 33
MaeIII GTNAC 1 cut(s) 149
MalI GATC 1 cut(s) 145
MboI GATC 1 cut(s) 143
MboII GAAGA 3 cut(s) 69, 83, 179
MflI RGATCY 1 cut(s) 143
MluCI AATT 2 cut(s) 284, 338
MroXI GAANNNNTTC 1 cut(s) 90
MseI TTAA 1 cut(s) 378
MslI CAYNNNNRTG 1 cut(s) 131
NdeII GATC 1 cut(s) 143
NlaIII CATG 3 cut(s) 56, 64, 337
NspI RCATGY 1 cut(s) 64
PciI ACATGT 1 cut(s) 60
PdmI GAANNNNTTC 1 cut(s) 90
PfeI GAWTC 3 cut(s) 86, 122, 308
PscI ACATGT 1 cut(s) 60
PsuI RGATCY 1 cut(s) 143
RsaI GTAC 1 cut(s) 365
RsaNI GTAC 1 cut(s) 364
RseI CAYNNNNRTG 1 cut(s) 131
SaqAI TTAA 1 cut(s) 378
Sau3AI GATC 1 cut(s) 143
SetI ASST 2 cut(s) 44, 180
SfaNI GCATC 2 cut(s) 13, 199
SmiMI CAYNNNNRTG 1 cut(s) 131
Sse9I AATT 2 cut(s) 284, 338
SspMI CTAG 1 cut(s) 33
TaaI ACNGT 1 cut(s) 323
TaqI TCGA 1 cut(s) 162
TasI AATT 2 cut(s) 284, 338
TfiI GAWTC 3 cut(s) 86, 122, 308
Tru1I TTAA 1 cut(s) 378
Tru9I TTAA 1 cut(s) 378
TscAI CASTG 1 cut(s) 351
TspDTI ATGAA 3 cut(s) 99, 180, 401
TspRI CASTG 1 cut(s) 351
XapI RAATTY 1 cut(s) 284
XceI RCATGY 1 cut(s) 64
XmnI GAANNNNTTC 1 cut(s) 90
XspI CTAG 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.