Prupe.1G578200_v2.0.a1
BHLH Family

Transcription factor ABORTED

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
47059631 .. 47060827
1197 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G578200.1

Sequence Viewer

Length: 297 bp
ATGAGCACTGAAATACAACCACAGCCCTTTCCAGGCAATGAGAATGAAGGAAATGATCATCTAAACAGTAATCATTTCCAGCAGTCGCCTGTTGTTTCCCCAGTGGATCATGATTCGAATGTGCCATACGACATATCAGTTGATCGAATCCTTCTCTGCCGCACTTCTCCAATGAATGTCCTGCAACATGCCACTTACAACTCAGAGAACAGCATGAAGAATGTCCTTGTTTTTGTGAGAATTGATAATGCCCTTGTATTTGATAGAGGTCATGTGTTGATCGCTGAACAAGAATGA

Protein Analysis

99

Amino Acids

11.07

Weight (kDa)

4.81

Isoelectric Point (pI)

61.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024594)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 160
AclWI GGATC 1 cut(s) 114
AfiI CCNNNNNNNGG 1 cut(s) 32
AjnI CCWGG 1 cut(s) 31
Alw21I GWGCWC 1 cut(s) 8
AlwI GGATC 1 cut(s) 114
AsuII TTCGAA 1 cut(s) 116
Bbv12I GWGCWC 1 cut(s) 8
BciT130I CCWGG 1 cut(s) 33
BclI TGATCA 1 cut(s) 55
BisI GCNGC 1 cut(s) 160
BlsI GCNGC 1 cut(s) 161
Bme1390I CCNGG 1 cut(s) 33
BmrFI CCNGG 1 cut(s) 33
BmrI ACTGGG 1 cut(s) 95
BmuI ACTGGG 1 cut(s) 95
Bpu14I TTCGAA 1 cut(s) 116
Bsc4I CCNNNNNNNGG 1 cut(s) 32
Bse1I ACTGG 1 cut(s) 101
Bse3DI GCAATG 1 cut(s) 43
BseBI CCWGG 1 cut(s) 33
BseLI CCNNNNNNNGG 1 cut(s) 32
BseMI GCAATG 1 cut(s) 43
BseMII CTCAG 1 cut(s) 216
BseNI ACTGG 1 cut(s) 101
BsiHKAI GWGCWC 1 cut(s) 8
BslI CCNNNNNNNGG 1 cut(s) 32
Bsp119I TTCGAA 1 cut(s) 116
Bsp1286I GDGCHC 1 cut(s) 8
Bsp143I GATC 4 cut(s) 55, 106, 142, 279
BspACI CCGC 1 cut(s) 160
BspCNI CTCAG 1 cut(s) 215
BspHI TCATGA 1 cut(s) 109
BspPI GGATC 1 cut(s) 114
BspT104I TTCGAA 1 cut(s) 116
BsrDI GCAATG 1 cut(s) 43
BsrI ACTGG 1 cut(s) 101
BssMI GATC 4 cut(s) 55, 106, 142, 279
Bst2UI CCWGG 1 cut(s) 33
Bst4CI ACNGT 1 cut(s) 68
BstBI TTCGAA 1 cut(s) 116
BstDEI CTNAG 1 cut(s) 202
BstKTI GATC 4 cut(s) 58, 109, 145, 282
BstMBI GATC 4 cut(s) 55, 106, 142, 279
BstNI CCWGG 1 cut(s) 33
BstNSI RCATGY 1 cut(s) 191
BstSCI CCNGG 1 cut(s) 31
BtsIMutI CAGTG 2 cut(s) 6, 108
CciI TCATGA 1 cut(s) 109
CviAII CATG 4 cut(s) 110, 188, 214, 272
CviJI RGCY 1 cut(s) 25
CviKI_1 RGCY 1 cut(s) 25
DdeI CTNAG 1 cut(s) 202
DpnI GATC 4 cut(s) 57, 108, 144, 281
DpnII GATC 4 cut(s) 55, 106, 142, 279
EcoRII CCWGG 1 cut(s) 31
FaeI CATG 4 cut(s) 113, 191, 217, 275
FaiI YATR 6 cut(s) 111, 127, 134, 189, 215, 273
FatI CATG 4 cut(s) 109, 187, 213, 271
FbaI TGATCA 1 cut(s) 55
Fnu4HI GCNGC 1 cut(s) 160
Fsp4HI GCNGC 1 cut(s) 160
GluI GCNGC 1 cut(s) 160
Hin1II CATG 4 cut(s) 113, 191, 217, 275
HinfI GANTC 2 cut(s) 113, 147
Hpy188I TCNGA 1 cut(s) 205
Hpy188III TCNNGA 1 cut(s) 110
HpyAV CCTTC 2 cut(s) 41, 161
HpyCH4III ACNGT 1 cut(s) 68
HpyCH4V TGCA 1 cut(s) 184
HpyF3I CTNAG 1 cut(s) 202
Hsp92II CATG 4 cut(s) 113, 191, 217, 275
Ksp22I TGATCA 1 cut(s) 55
Kzo9I GATC 4 cut(s) 55, 106, 142, 279
LpnPI CCDG 6 cut(s) 18, 45, 92, 102, 114, 194
MalI GATC 4 cut(s) 57, 108, 144, 281
MboI GATC 4 cut(s) 55, 106, 142, 279
MboII GAAGA 1 cut(s) 229
MhlI GDGCHC 1 cut(s) 8
MluCI AATT 1 cut(s) 240
MnlI CCTC 1 cut(s) 260
MspR9I CCNGG 1 cut(s) 33
MvaI CCWGG 1 cut(s) 33
NdeII GATC 4 cut(s) 55, 106, 142, 279
NlaIII CATG 4 cut(s) 113, 191, 217, 275
NspI RCATGY 1 cut(s) 191
NspV TTCGAA 1 cut(s) 116
PagI TCATGA 1 cut(s) 109
PfeI GAWTC 2 cut(s) 113, 147
PkrI GCNGC 1 cut(s) 161
Psp6I CCWGG 1 cut(s) 31
PspGI CCWGG 1 cut(s) 31
SatI GCNGC 1 cut(s) 160
Sau3AI GATC 4 cut(s) 55, 106, 142, 279
ScrFI CCNGG 1 cut(s) 33
SduI GDGCHC 1 cut(s) 8
SetI ASST 1 cut(s) 271
SfuI TTCGAA 1 cut(s) 116
Sse9I AATT 1 cut(s) 240
SsiI CCGC 1 cut(s) 160
StyD4I CCNGG 1 cut(s) 31
TaaI ACNGT 1 cut(s) 68
TaqI TCGA 2 cut(s) 116, 145
TasI AATT 1 cut(s) 240
TauI GCSGC 1 cut(s) 162
TfiI GAWTC 2 cut(s) 113, 147
TscAI CASTG 2 cut(s) 13, 108
TspDTI ATGAA 3 cut(s) 60, 188, 230
TspRI CASTG 2 cut(s) 13, 108
XceI RCATGY 1 cut(s) 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.