Prupe.3G075000_v2.0.a1

Cysteine-rich TM module stress tolerance

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
Physical Location & Seq
Forward (+)
5493298 .. 5494487
1190 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G075000.1

Sequence Viewer

Length: 168 bp
ATGGCTGGTGCACCACCTACACAAAGGATGTCATGCTGTGATCAGGTCCAGAAGCGCAAGGAGGAGAAAGGCTGCTTCTATTCTTGTTTGTTTGCATTTTTCTGCTGCTGTTGCTGCTATAAGACTTGTGAGCCTTGCTTAAACGGCGTCTGCTGTTGCTGCCCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.14

Weight (kDa)

7.89

Isoelectric Point (pI)

64.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024309)

Species Orthologous Gene IDs
malus_domestica MD09G1216200.v1.1
prunus_persica Prupe.3G075000_v2.0.a1
pyrus_communis pycom09g13310

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcyI GRCGYC 1 cut(s) 147
Alw21I GWGCWC 1 cut(s) 13
Alw44I GTGCAC 1 cut(s) 9
ApaLI GTGCAC 1 cut(s) 9
ApeKI GCWGC 4 cut(s) 72, 105, 114, 159
AspLEI GCGC 1 cut(s) 57
AspS9I GGNCC 1 cut(s) 46
AvaII GGWCC 1 cut(s) 46
BaeGI GKGCMC 1 cut(s) 13
Bbv12I GWGCWC 1 cut(s) 13
BbvI GCAGC 4 cut(s) 59, 92, 101, 146
BceAI ACGGC 1 cut(s) 160
BclI TGATCA 1 cut(s) 40
BfaI CTAG 1 cut(s) 166
BisI GCNGC 4 cut(s) 73, 106, 115, 160
BlsI GCNGC 4 cut(s) 74, 107, 116, 161
Bme18I GGWCC 1 cut(s) 46
BmgT120I GGNCC 1 cut(s) 46
BsaHI GRCGYC 1 cut(s) 147
BseGI GGATG 1 cut(s) 33
BseRI GAGGAG 1 cut(s) 77
BseSI GKGCMC 1 cut(s) 13
BseXI GCAGC 4 cut(s) 59, 92, 101, 146
BsiHKAI GWGCWC 1 cut(s) 13
Bsp1286I GDGCHC 1 cut(s) 13
Bsp143I GATC 1 cut(s) 40
BssMI GATC 1 cut(s) 40
BssNI GRCGYC 1 cut(s) 147
BstACI GRCGYC 1 cut(s) 147
BstF5I GGATG 1 cut(s) 33
BstHHI GCGC 1 cut(s) 57
BstKTI GATC 1 cut(s) 43
BstMBI GATC 1 cut(s) 40
BstMWI GCNNNNNNNGC 4 cut(s) 111, 114, 144, 159
BstSLI GKGCMC 1 cut(s) 13
BstV1I GCAGC 4 cut(s) 59, 92, 101, 146
BtsCI GGATG 1 cut(s) 33
CfoI GCGC 1 cut(s) 57
Cfr13I GGNCC 1 cut(s) 46
CseI GACGC 1 cut(s) 136
CviAII CATG 1 cut(s) 33
CviJI RGCY 3 cut(s) 5, 72, 133
CviKI_1 RGCY 3 cut(s) 5, 72, 133
DpnI GATC 1 cut(s) 42
DpnII GATC 1 cut(s) 40
Eco47I GGWCC 1 cut(s) 46
FaeI CATG 1 cut(s) 36
FaiI YATR 2 cut(s) 34, 120
FatI CATG 1 cut(s) 32
FbaI TGATCA 1 cut(s) 40
Fnu4HI GCNGC 4 cut(s) 73, 106, 115, 160
FokI GGATG 1 cut(s) 40
Fsp4HI GCNGC 4 cut(s) 73, 106, 115, 160
FspBI CTAG 1 cut(s) 166
GlaI GCGC 1 cut(s) 56
GluI GCNGC 4 cut(s) 73, 106, 115, 160
HgaI GACGC 1 cut(s) 136
HhaI GCGC 1 cut(s) 57
Hin1I GRCGYC 1 cut(s) 147
Hin1II CATG 1 cut(s) 36
Hin6I GCGC 1 cut(s) 55
HinP1I GCGC 1 cut(s) 55
Hpy166II GTNNAC 1 cut(s) 11
Hpy188III TCNNGA 1 cut(s) 49
Hpy8I GTNNAC 1 cut(s) 11
HpyCH4V TGCA 2 cut(s) 11, 95
HpyF10VI GCNNNNNNNGC 4 cut(s) 111, 114, 144, 159
Hsp92I GRCGYC 1 cut(s) 147
Hsp92II CATG 1 cut(s) 36
HspAI GCGC 1 cut(s) 55
Ksp22I TGATCA 1 cut(s) 40
Kzo9I GATC 1 cut(s) 40
LpnPI CCDG 2 cut(s) 29, 62
Lsp1109I GCAGC 4 cut(s) 59, 92, 101, 146
MaeI CTAG 1 cut(s) 166
MalI GATC 1 cut(s) 42
MboI GATC 1 cut(s) 40
MhlI GDGCHC 1 cut(s) 13
MnlI CCTC 1 cut(s) 55
MseI TTAA 1 cut(s) 140
MwoI GCNNNNNNNGC 4 cut(s) 111, 114, 144, 159
NdeII GATC 1 cut(s) 40
NlaIII CATG 1 cut(s) 36
PkrI GCNGC 4 cut(s) 74, 107, 116, 161
PspPI GGNCC 1 cut(s) 46
SaqAI TTAA 1 cut(s) 140
SatI GCNGC 4 cut(s) 73, 106, 115, 160
Sau3AI GATC 1 cut(s) 40
Sau96I GGNCC 1 cut(s) 46
SduI GDGCHC 1 cut(s) 13
SetI ASST 2 cut(s) 19, 48
SgeI CNNG 8 cut(s) 18, 45, 56, 61, 70, 96, 138, 147
SinI GGWCC 1 cut(s) 46
SspMI CTAG 1 cut(s) 166
Tru1I TTAA 1 cut(s) 140
Tru9I TTAA 1 cut(s) 140
TseI GCWGC 4 cut(s) 72, 105, 114, 159
VneI GTGCAC 1 cut(s) 9
VpaK11BI GGWCC 1 cut(s) 46
XspI CTAG 1 cut(s) 166
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.