Prupe.3G158700_v2.0.a1
MYB Family

SANT SWI3, ADA2, N-CoR and TFIIIB'' DNA-binding domains

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
OG0024317
Physical Location & Seq
Forward (+)
17727041 .. 17728722
1682 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G158700.1

Sequence Viewer

Length: 717 bp
ATGAGAAAACCTTGCTGTGAAAAAGAAGGCACAAACAAAGGAGCTTGGTCTAAACAAGAAGACCAAAAACTCATTGATTACATTAAAGCTCATGGGGAAGGCTGTTGGCGATCTCTCCCCAAGGCTGCAGGGTTGCACCGCTGTGGCAAAAGTTGTAGGCTAAGATGGATAAACTATCTAAGGCCAGACATCAAACGTGGAAACTTTGAGCAAGATGAAGAAGACCTCATCATCAAACTACATGCCCTTCTTGGCAACCGGTGGTCGCTTATTGCTGGAAGGTTGCCAGGGAGGACGGACAACGAGGTGAAGAACTATTGGAATTCTCACATCCGGAAGAAGCTAATTAAAATGGGCATTGATCCCAATAACCATAGGCTAAACCAGATCATTCCTCGTCCGAATCCTCAAAACGACTGTGTTTCTGCTGCTGCAACATCATCTGGATCAATGAGCAATATTAGTGCATGTACTAAAGCACCAATCAAGTCTTCACGTGAAATTGATCAAAGGGCCTCACAAGCTACAAGTGTTCTTGAAGATGAAACTTCTGGTTCATCATCTCGTGACTTGAATCTCGACCTCACCATTGCTTTTCCTAATCCTCCACTACTAGTTGGGGAAGAGATGCAAAAAAATATTAAAGGGTCCTTCACTATGGCGAGAGAAATCGAAACCAACCTTCAACATTCACCCACTCTTGCTCTTTTTAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-binding

Protein Analysis

239

Amino Acids

26.78

Weight (kDa)

9.28

Isoelectric Point (pI)

49.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024317)

Species Orthologous Gene IDs
malus_domestica MD09G1261200.v1.1
prunus_persica Prupe.3G158700_v2.0.a1
pyrus_communis pycom09g17570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 333
AciI CCGC 1 cut(s) 139
AclWI GGATC 2 cut(s) 356, 454
AcsI RAATTY 1 cut(s) 322
AcvI CACGTG 1 cut(s) 497
AfaI GTAC 1 cut(s) 472
AgeI ACCGGT 1 cut(s) 258
AgsI TTSAA 3 cut(s) 539, 574, 686
AhlI ACTAGT 1 cut(s) 613
AjnI CCWGG 1 cut(s) 286
AjuI GAANNNNNNNTTGG 2 cut(s) 475, 507
AleI CACNNNNGTG 1 cut(s) 141
AluBI AGCT 4 cut(s) 44, 89, 343, 524
AluI AGCT 4 cut(s) 44, 89, 343, 524
AlwI GGATC 2 cut(s) 356, 454
Aor13HI TCCGGA 1 cut(s) 333
AoxI GGCC 2 cut(s) 182, 513
ApeKI GCWGC 3 cut(s) 125, 428, 431
ApoI RAATTY 1 cut(s) 322
AsiGI ACCGGT 1 cut(s) 258
AspS9I GGNCC 2 cut(s) 513, 648
AsuHPI GGTGA 3 cut(s) 319, 577, 684
AvaII GGWCC 1 cut(s) 648
BauI CACGAG 1 cut(s) 564
BbrPI CACGTG 1 cut(s) 497
BbsI GAAGAC 3 cut(s) 66, 228, 483
BbvI GCAGC 3 cut(s) 112, 415, 418
BccI CCATC 1 cut(s) 159
BciT130I CCWGG 1 cut(s) 288
BclI TGATCA 1 cut(s) 505
BcuI ACTAGT 1 cut(s) 613
BfaI CTAG 1 cut(s) 614
BfmI CTRYAG 1 cut(s) 126
BisI GCNGC 3 cut(s) 126, 429, 432
BlsI GCNGC 3 cut(s) 127, 430, 433
Bme1390I CCNGG 1 cut(s) 288
Bme18I GGWCC 1 cut(s) 648
BmgT120I GGNCC 2 cut(s) 513, 648
BmiI GGNNCC 1 cut(s) 649
BmrFI CCNGG 1 cut(s) 288
BmsI GCATC 1 cut(s) 618
BpiI GAAGAC 3 cut(s) 66, 228, 483
BsaAI YACGTR 1 cut(s) 497
BsaJI CCNNGG 2 cut(s) 120, 287
BsaWI WCCGGW 2 cut(s) 258, 333
Bse118I RCCGGY 1 cut(s) 258
Bse3DI GCAATG 1 cut(s) 588
BseAI TCCGGA 1 cut(s) 333
BseBI CCWGG 1 cut(s) 288
BseDI CCNNGG 2 cut(s) 120, 287
BseGI GGATG 1 cut(s) 330
BseMI GCAATG 1 cut(s) 588
BseXI GCAGC 3 cut(s) 112, 415, 418
BshFI GGCC 2 cut(s) 184, 515
BshTI ACCGGT 1 cut(s) 258
BsiSI CCGG 2 cut(s) 259, 334
BsnI GGCC 2 cut(s) 184, 515
Bsp13I TCCGGA 1 cut(s) 333
Bsp143I GATC 5 cut(s) 110, 361, 387, 446, 505
BspACI CCGC 1 cut(s) 139
BspANI GGCC 2 cut(s) 184, 515
BspEI TCCGGA 1 cut(s) 333
BspLI GGNNCC 1 cut(s) 649
BspMAI CTGCAG 1 cut(s) 130
BspPI GGATC 2 cut(s) 356, 454
BsrDI GCAATG 1 cut(s) 588
BsrFI RCCGGY 1 cut(s) 258
BssAI RCCGGY 1 cut(s) 258
BssECI CCNNGG 2 cut(s) 120, 287
BssMI GATC 5 cut(s) 110, 361, 387, 446, 505
BssSI CACGAG 1 cut(s) 564
BssT1I CCWWGG 1 cut(s) 120
Bst2BI CACGAG 1 cut(s) 564
Bst2UI CCWGG 1 cut(s) 288
Bst4CI ACNGT 1 cut(s) 419
Bst6I CTCTTC 1 cut(s) 618
BstBAI YACGTR 1 cut(s) 497
BstDEI CTNAG 2 cut(s) 161, 179
BstF5I GGATG 1 cut(s) 330
BstKTI GATC 5 cut(s) 113, 364, 390, 449, 508
BstMBI GATC 5 cut(s) 110, 361, 387, 446, 505
BstMWI GCNNNNNNNGC 1 cut(s) 521
BstNI CCWGG 1 cut(s) 288
BstNSI RCATGY 2 cut(s) 245, 471
BstSCI CCNGG 1 cut(s) 286
BstSFI CTRYAG 1 cut(s) 126
BstV1I GCAGC 3 cut(s) 112, 415, 418
BstV2I GAAGAC 3 cut(s) 66, 228, 483
BsuRI GGCC 2 cut(s) 184, 515
BtsCI GGATG 1 cut(s) 330
Cfr10I RCCGGY 1 cut(s) 258
Cfr13I GGNCC 2 cut(s) 513, 648
Csp6I GTAC 1 cut(s) 471
CspAI ACCGGT 1 cut(s) 258
CviAII CATG 3 cut(s) 92, 242, 468
CviQI GTAC 1 cut(s) 471
DdeI CTNAG 2 cut(s) 161, 179
DpnI GATC 5 cut(s) 112, 363, 389, 448, 507
DpnII GATC 5 cut(s) 110, 361, 387, 446, 505
Eam1104I CTCTTC 1 cut(s) 618
EarI CTCTTC 1 cut(s) 618
Eco130I CCWWGG 1 cut(s) 120
Eco47I GGWCC 1 cut(s) 648
Eco72I CACGTG 1 cut(s) 497
EcoO109I RGGNCCY 2 cut(s) 513, 648
EcoRI GAATTC 1 cut(s) 322
EcoRII CCWGG 1 cut(s) 286
EcoT14I CCWWGG 1 cut(s) 120
ErhI CCWWGG 1 cut(s) 120
FaeI CATG 3 cut(s) 95, 245, 471
FaiI YATR 5 cut(s) 93, 243, 375, 469, 659
FatI CATG 3 cut(s) 91, 241, 467
FbaI TGATCA 1 cut(s) 505
Fnu4HI GCNGC 3 cut(s) 126, 429, 432
FokI GGATG 1 cut(s) 317
Fsp4HI GCNGC 3 cut(s) 126, 429, 432
FspBI CTAG 1 cut(s) 614
GluI GCNGC 3 cut(s) 126, 429, 432
HaeIII GGCC 2 cut(s) 184, 515
HapII CCGG 2 cut(s) 259, 334
Hin1II CATG 3 cut(s) 95, 245, 471
HinfI GANTC 2 cut(s) 403, 574
HpaII CCGG 2 cut(s) 259, 334
HphI GGTGA 3 cut(s) 319, 577, 684
Hpy188I TCNGA 1 cut(s) 402
Hpy188III TCNNGA 5 cut(s) 334, 444, 536, 566, 578
HpyAV CCTTC 6 cut(s) 20, 92, 257, 273, 661, 692
HpyCH4III ACNGT 1 cut(s) 419
HpyCH4IV ACGT 2 cut(s) 196, 496
HpyCH4V TGCA 5 cut(s) 128, 136, 434, 467, 631
HpyF10VI GCNNNNNNNGC 1 cut(s) 521
HpyF3I CTNAG 2 cut(s) 161, 179
HpySE526I ACGT 2 cut(s) 196, 496
Hsp92II CATG 3 cut(s) 95, 245, 471
Kpn2I TCCGGA 1 cut(s) 333
Ksp22I TGATCA 1 cut(s) 505
Kzo9I GATC 5 cut(s) 110, 361, 387, 446, 505
LmnI GCTCC 1 cut(s) 41
Lsp1109I GCAGC 3 cut(s) 112, 415, 418
LweI GCATC 1 cut(s) 618
MaeI CTAG 1 cut(s) 614
MaeII ACGT 2 cut(s) 196, 496
MaeIII GTNAC 1 cut(s) 566
MalI GATC 5 cut(s) 112, 363, 389, 448, 507
MboI GATC 5 cut(s) 110, 361, 387, 446, 505
MboII GAAGA 8 cut(s) 71, 230, 233, 322, 349, 483, 551, 635
MluCI AATT 3 cut(s) 322, 345, 501
MnlI CCTC 8 cut(s) 236, 285, 298, 405, 417, 526, 593, 615
MroI TCCGGA 1 cut(s) 333
MseI TTAA 3 cut(s) 84, 348, 642
MslI CAYNNNNRTG 1 cut(s) 141
MspA1I CMGCKG 1 cut(s) 141
MspI CCGG 2 cut(s) 259, 334
MspR9I CCNGG 1 cut(s) 288
MvaI CCWGG 1 cut(s) 288
MwoI GCNNNNNNNGC 1 cut(s) 521
NdeII GATC 5 cut(s) 110, 361, 387, 446, 505
NlaIII CATG 3 cut(s) 95, 245, 471
NlaIV GGNNCC 1 cut(s) 649
NmuCI GTSAC 1 cut(s) 566
NspI RCATGY 2 cut(s) 245, 471
OliI CACNNNNGTG 1 cut(s) 141
PfeI GAWTC 2 cut(s) 403, 574
PinAI ACCGGT 1 cut(s) 258
PkrI GCNGC 3 cut(s) 127, 430, 433
PmaCI CACGTG 1 cut(s) 497
PmlI CACGTG 1 cut(s) 497
Ppu21I YACGTR 1 cut(s) 497
PpuMI RGGWCCY 1 cut(s) 648
Psp5II RGGWCCY 1 cut(s) 648
Psp6I CCWGG 1 cut(s) 286
PspCI CACGTG 1 cut(s) 497
PspGI CCWGG 1 cut(s) 286
PspN4I GGNNCC 1 cut(s) 649
PspPI GGNCC 2 cut(s) 513, 648
PspPPI RGGWCCY 1 cut(s) 648
PstI CTGCAG 1 cut(s) 130
RsaI GTAC 1 cut(s) 472
RsaNI GTAC 1 cut(s) 471
RseI CAYNNNNRTG 1 cut(s) 141
SaqAI TTAA 3 cut(s) 84, 348, 642
SatI GCNGC 3 cut(s) 126, 429, 432
Sau3AI GATC 5 cut(s) 110, 361, 387, 446, 505
Sau96I GGNCC 2 cut(s) 513, 648
ScrFI CCNGG 1 cut(s) 288
SfaNI GCATC 1 cut(s) 618
SfcI CTRYAG 1 cut(s) 126
SinI GGWCC 1 cut(s) 648
SmiMI CAYNNNNRTG 1 cut(s) 141
SpeI ACTAGT 1 cut(s) 613
Sse9I AATT 3 cut(s) 322, 345, 501
SsiI CCGC 1 cut(s) 139
SspI AATATT 2 cut(s) 460, 640
SspMI CTAG 1 cut(s) 614
StyD4I CCNGG 1 cut(s) 286
StyI CCWWGG 1 cut(s) 120
TaaI ACNGT 1 cut(s) 419
TaiI ACGT 2 cut(s) 199, 499
TaqI TCGA 2 cut(s) 579, 672
TasI AATT 3 cut(s) 322, 345, 501
TatI WGTACW 1 cut(s) 470
TfiI GAWTC 2 cut(s) 403, 574
Tru1I TTAA 3 cut(s) 84, 348, 642
Tru9I TTAA 3 cut(s) 84, 348, 642
TseFI GTSAC 1 cut(s) 566
TseI GCWGC 3 cut(s) 125, 428, 431
Tsp45I GTSAC 1 cut(s) 566
TspDTI ATGAA 3 cut(s) 231, 546, 558
TspGWI ACGGA 1 cut(s) 311
VpaK11BI GGWCC 1 cut(s) 648
XapI RAATTY 1 cut(s) 322
XceI RCATGY 2 cut(s) 245, 471
XspI CTAG 1 cut(s) 614
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.