Prupe.4G246300_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
OG0022476
Physical Location & Seq
Reverse (-)
16362043 .. 16362652
610 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G246300.1

Sequence Viewer

Length: 270 bp
ATGGCGCATTCACGAAGAAACATGCTAGTGCAGTTTCATCACCCAATCCAACATGGCTGTTTCATTTTCATCCTTTTATTCTCTTCCATTATTTCTATCAATATTCATGCATGCAATTCCACTCTGTCTTCTCCTCAACCTTTTAATCGATCTGACCAAGCCCCTGAGCTATTCGGGATCACCGCTAAACATGGTATTCGGGCCTTCGTTCGGAAACTTCCAACCCTATTAAACAAAGGGAACACCGCCGGTGGTGGGATCATAGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

9.78

Weight (kDa)

10.9

Isoelectric Point (pI)

55.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022476)

Species Orthologous Gene IDs
prunus_persica Prupe.4G246300_v2.0.a1 Prupe.4G246300_v2.0.a1 Prupe.4G246700_v2.0.a1 Prupe.4G247200_v2.0.a1

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 183, 246
AclWI GGATC 2 cut(s) 185, 266
AfiI CCNNNNNNNGG 2 cut(s) 210, 255
AluBI AGCT 1 cut(s) 169
AluI AGCT 1 cut(s) 169
AlwI GGATC 2 cut(s) 185, 266
AoxI GGCC 1 cut(s) 201
AspLEI GCGC 1 cut(s) 7
AspS9I GGNCC 1 cut(s) 201
AsuHPI GGTGA 2 cut(s) 32, 172
BbsI GAAGAC 1 cut(s) 120
BfaI CTAG 1 cut(s) 26
BmgT120I GGNCC 1 cut(s) 201
BpiI GAAGAC 1 cut(s) 120
Bpu10I CCTNAGC 1 cut(s) 165
Bsa29I ATCGAT 1 cut(s) 148
Bsc4I CCNNNNNNNGG 2 cut(s) 210, 255
Bse118I RCCGGY 1 cut(s) 248
BseCI ATCGAT 1 cut(s) 148
BseGI GGATG 1 cut(s) 69
BseLI CCNNNNNNNGG 2 cut(s) 210, 255
BseMII CTCAG 1 cut(s) 156
BseRI GAGGAG 1 cut(s) 123
BsgI GTGCAG 1 cut(s) 50
BshFI GGCC 1 cut(s) 203
BshVI ATCGAT 1 cut(s) 148
BsiSI CCGG 1 cut(s) 249
BslI CCNNNNNNNGG 2 cut(s) 210, 255
BsmI GAATGC 1 cut(s) 7
BsnI GGCC 1 cut(s) 203
Bsp143I GATC 3 cut(s) 149, 177, 258
BspACI CCGC 2 cut(s) 183, 246
BspANI GGCC 1 cut(s) 203
BspCNI CTCAG 1 cut(s) 157
BspDI ATCGAT 1 cut(s) 148
BspPI GGATC 2 cut(s) 185, 266
BsrFI RCCGGY 1 cut(s) 248
BssAI RCCGGY 1 cut(s) 248
BssMI GATC 3 cut(s) 149, 177, 258
Bst6I CTCTTC 1 cut(s) 88
BstC8I GCNNGC 1 cut(s) 112
BstDEI CTNAG 1 cut(s) 165
BstF5I GGATG 1 cut(s) 69
BstHHI GCGC 1 cut(s) 7
BstKTI GATC 3 cut(s) 152, 180, 261
BstMBI GATC 3 cut(s) 149, 177, 258
BstNSI RCATGY 2 cut(s) 25, 114
BstV2I GAAGAC 1 cut(s) 120
Bsu15I ATCGAT 1 cut(s) 148
BsuRI GGCC 1 cut(s) 203
BsuTUI ATCGAT 1 cut(s) 148
BtsCI GGATG 1 cut(s) 69
Cac8I GCNNGC 1 cut(s) 112
CfoI GCGC 1 cut(s) 7
Cfr10I RCCGGY 1 cut(s) 248
Cfr13I GGNCC 1 cut(s) 201
ClaI ATCGAT 1 cut(s) 148
CviAII CATG 5 cut(s) 22, 53, 107, 111, 191
CviJI RGCY 4 cut(s) 57, 161, 169, 203
CviKI_1 RGCY 4 cut(s) 57, 161, 169, 203
DdeI CTNAG 1 cut(s) 165
DpnI GATC 3 cut(s) 151, 179, 260
DpnII GATC 3 cut(s) 149, 177, 258
Eam1104I CTCTTC 1 cut(s) 88
EarI CTCTTC 1 cut(s) 88
EcoT22I ATGCAT 1 cut(s) 112
FaeI CATG 5 cut(s) 25, 56, 110, 114, 194
FaiI YATR 7 cut(s) 23, 54, 108, 112, 192, 263, 268
FatI CATG 5 cut(s) 21, 52, 106, 110, 190
FokI GGATG 1 cut(s) 56
FspBI CTAG 1 cut(s) 26
GlaI GCGC 1 cut(s) 6
HaeIII GGCC 1 cut(s) 203
HapII CCGG 1 cut(s) 249
HhaI GCGC 1 cut(s) 7
Hin1II CATG 5 cut(s) 25, 56, 110, 114, 194
Hin6I GCGC 1 cut(s) 5
HinP1I GCGC 1 cut(s) 5
HpaII CCGG 1 cut(s) 249
HphI GGTGA 2 cut(s) 32, 172
Hpy188I TCNGA 2 cut(s) 154, 213
Hpy188III TCNNGA 2 cut(s) 12, 175
HpyAV CCTTC 1 cut(s) 214
HpyCH4V TGCA 3 cut(s) 31, 110, 114
HpyF3I CTNAG 1 cut(s) 165
Hsp92II CATG 5 cut(s) 25, 56, 110, 114, 194
HspAI GCGC 1 cut(s) 5
Kzo9I GATC 3 cut(s) 149, 177, 258
LpnPI CCDG 2 cut(s) 177, 262
MaeI CTAG 1 cut(s) 26
MalI GATC 3 cut(s) 151, 179, 260
MboI GATC 3 cut(s) 149, 177, 258
MboII GAAGA 3 cut(s) 27, 75, 120
MluCI AATT 1 cut(s) 115
MmeI TCCRAC 2 cut(s) 73, 245
MnlI CCTC 1 cut(s) 144
Mph1103I ATGCAT 1 cut(s) 112
MseI TTAA 2 cut(s) 144, 230
MslI CAYNNNNRTG 1 cut(s) 26
MspI CCGG 1 cut(s) 249
Mva1269I GAATGC 1 cut(s) 7
NdeII GATC 3 cut(s) 149, 177, 258
NlaIII CATG 5 cut(s) 25, 56, 110, 114, 194
NsiI ATGCAT 1 cut(s) 112
NspI RCATGY 2 cut(s) 25, 114
PaeI GCATGC 1 cut(s) 114
PctI GAATGC 1 cut(s) 7
PspPI GGNCC 1 cut(s) 201
RseI CAYNNNNRTG 1 cut(s) 26
SaqAI TTAA 2 cut(s) 144, 230
Sau3AI GATC 3 cut(s) 149, 177, 258
Sau96I GGNCC 1 cut(s) 201
SetI ASST 2 cut(s) 142, 171
SgrAI CRCCGGYG 1 cut(s) 248
SmiMI CAYNNNNRTG 1 cut(s) 26
SphI GCATGC 1 cut(s) 114
Sse9I AATT 1 cut(s) 115
SsiI CCGC 2 cut(s) 183, 246
SspI AATATT 1 cut(s) 103
SspMI CTAG 1 cut(s) 26
TaqI TCGA 1 cut(s) 148
TasI AATT 1 cut(s) 115
Tru1I TTAA 2 cut(s) 144, 230
Tru9I TTAA 2 cut(s) 144, 230
TspDTI ATGAA 4 cut(s) 26, 52, 58, 95
XceI RCATGY 2 cut(s) 25, 114
XspI CTAG 1 cut(s) 26
Zsp2I ATGCAT 1 cut(s) 112
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.