Prupe.7G255600_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
Physical Location & Seq
Forward (+)
21438191 .. 21438769
579 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G255600.1

Sequence Viewer

Length: 138 bp
ATGAAGCAAATTGTTACCAAAGCTTCTTCTATTACCCAAAAAGCAAAGAATGGTTTGGAAACTCACACAATGATTGCAGAGCCATTGGAGAGAGGACTTGCGGAGGACATTGACACAAGGTACCTAACATTCTATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

46

Amino Acids

5.11

Weight (kDa)

6.54

Isoelectric Point (pI)

20.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022374)

Species Orthologous Gene IDs
malus_domestica MD02G1298800.v1.1
prunus_persica Prupe.7G255600_v2.0.a1
pyrus_communis pycom111g01340 pycom17g24230

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 120
AccB1I GGYRCC 1 cut(s) 120
AciI CCGC 1 cut(s) 101
AfaI GTAC 1 cut(s) 122
AluBI AGCT 1 cut(s) 23
AluI AGCT 1 cut(s) 23
Asp718I GGTACC 1 cut(s) 120
BanI GGYRCC 1 cut(s) 120
BmiI GGNNCC 1 cut(s) 122
BshNI GGYRCC 1 cut(s) 120
BspACI CCGC 1 cut(s) 101
BspLI GGNNCC 1 cut(s) 122
BspT107I GGYRCC 1 cut(s) 120
Csp6I GTAC 1 cut(s) 121
CviJI RGCY 2 cut(s) 23, 82
CviKI_1 RGCY 2 cut(s) 23, 82
CviQI GTAC 1 cut(s) 121
HindIII AAGCTT 1 cut(s) 21
HpyCH4V TGCA 1 cut(s) 77
KpnI GGTACC 1 cut(s) 124
MaeIII GTNAC 1 cut(s) 13
MboII GAAGA 1 cut(s) 18
MluCI AATT 1 cut(s) 9
MnlI CCTC 2 cut(s) 86, 97
NlaIV GGNNCC 1 cut(s) 122
PspN4I GGNNCC 1 cut(s) 122
RsaI GTAC 1 cut(s) 122
RsaNI GTAC 1 cut(s) 121
SetI ASST 3 cut(s) 25, 122, 126
SgeI CNNG 2 cut(s) 110, 129
Sse9I AATT 1 cut(s) 9
SsiI CCGC 1 cut(s) 101
TasI AATT 1 cut(s) 9
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.