pycom01g13750

Protein of unknown function (DUF3223)

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Reverse (-)
14141052 .. 14141590
539 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g13750.1

Sequence Viewer

Length: 411 bp
ATGGCATCATACAGATTATTATACAATGTTTGTCAGCATGGGAACATGCGTCAGAAAAAGAAAAGGAAAAATATAAAGGAGCAGATATTATTAAGATTGAAAACGCATTCCAGAAAGCATGGGGAAACTGTAAAAGTAACAAAAACTGTGATGGTGGAATGGATTAAATCCATAAAAGTGCAACAAAGAAAGGGTAAATCTGAGAAGAGTTTAACTGACGACCAGTCTTTTATACTTGATAATGTTATGAATTATCACCCGGATAAAGCTGTTAAAATGTGTTTTGGAATCAGTCGTCTCACAACATGTTTATTTACGCTGTTCTTGTTTAACTGCAAACAACTGCGTTTTATTATTATGTTTCAGTTTAGGTTTGATGGCATGAATATTTGTTACATCACACTAACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

137

Amino Acids

16.21

Weight (kDa)

10.07

Isoelectric Point (pI)

29.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022522)

Species Orthologous Gene IDs
pyrus_communis pycom01g13750 pycom02g25690 pycom07g02770 pycom13g22730

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 305
AgsI TTSAA 1 cut(s) 100
AhdI GACNNNNNGTC 1 cut(s) 223
AluBI AGCT 1 cut(s) 269
AluI AGCT 1 cut(s) 269
Alw26I GTCTC 1 cut(s) 302
AsuC2I CCSGG 1 cut(s) 260
AsuHPI GGTGA 1 cut(s) 248
BccI CCATC 2 cut(s) 145, 371
BcnI CCSGG 1 cut(s) 260
BcoDI GTCTC 1 cut(s) 302
Bme1390I CCNGG 1 cut(s) 260
BmeRI GACNNNNNGTC 1 cut(s) 223
BmrFI CCNGG 1 cut(s) 260
BmsI GCATC 1 cut(s) 14
BpuMI CCSGG 1 cut(s) 260
Bse1I ACTGG 1 cut(s) 223
BseMII CTCAG 1 cut(s) 192
BseNI ACTGG 1 cut(s) 223
BsiSI CCGG 1 cut(s) 260
BsmAI GTCTC 1 cut(s) 302
BsmBI CGTCTC 1 cut(s) 302
BsmI GAATGC 1 cut(s) 106
BspCNI CTCAG 1 cut(s) 193
BsrI ACTGG 1 cut(s) 223
Bst4CI ACNGT 2 cut(s) 130, 148
Bst6I CTCTTC 1 cut(s) 200
BstDEI CTNAG 1 cut(s) 201
BstMAI GTCTC 1 cut(s) 302
BstNSI RCATGY 2 cut(s) 49, 309
BstSCI CCNGG 1 cut(s) 258
CseI GACGC 1 cut(s) 38
CviAII CATG 5 cut(s) 38, 46, 119, 306, 382
CviJI RGCY 1 cut(s) 269
CviKI_1 RGCY 1 cut(s) 269
DdeI CTNAG 1 cut(s) 201
DriI GACNNNNNGTC 1 cut(s) 223
Eam1104I CTCTTC 1 cut(s) 200
Eam1105I GACNNNNNGTC 1 cut(s) 223
EarI CTCTTC 1 cut(s) 200
Esp3I CGTCTC 1 cut(s) 302
FaeI CATG 5 cut(s) 41, 49, 122, 309, 385
FatI CATG 5 cut(s) 37, 45, 118, 305, 381
HapII CCGG 1 cut(s) 260
HgaI GACGC 1 cut(s) 38
Hin1II CATG 5 cut(s) 41, 49, 122, 309, 385
HinfI GANTC 1 cut(s) 288
HpaII CCGG 1 cut(s) 260
HphI GGTGA 1 cut(s) 248
Hpy188I TCNGA 2 cut(s) 54, 202
Hpy188III TCNNGA 1 cut(s) 111
HpyCH4III ACNGT 2 cut(s) 130, 148
HpyCH4V TGCA 2 cut(s) 181, 336
HpyF3I CTNAG 1 cut(s) 201
Hsp92II CATG 5 cut(s) 41, 49, 122, 309, 385
LmnI GCTCC 1 cut(s) 79
LpnPI CCDG 3 cut(s) 124, 236, 273
LweI GCATC 1 cut(s) 14
MaeIII GTNAC 2 cut(s) 136, 392
MboII GAAGA 1 cut(s) 217
MluCI AATT 1 cut(s) 250
MseI TTAA 6 cut(s) 92, 165, 212, 273, 330, 409
MslI CAYNNNNRTG 1 cut(s) 176
MspI CCGG 1 cut(s) 260
MspR9I CCNGG 1 cut(s) 260
Mva1269I GAATGC 1 cut(s) 106
NciI CCSGG 1 cut(s) 260
NlaIII CATG 5 cut(s) 41, 49, 122, 309, 385
NspI RCATGY 2 cut(s) 49, 309
PciI ACATGT 1 cut(s) 305
PctI GAATGC 1 cut(s) 106
PfeI GAWTC 1 cut(s) 288
PscI ACATGT 1 cut(s) 305
RseI CAYNNNNRTG 1 cut(s) 176
SaqAI TTAA 6 cut(s) 92, 165, 212, 273, 330, 409
ScrFI CCNGG 1 cut(s) 260
SetI ASST 2 cut(s) 271, 374
SfaNI GCATC 1 cut(s) 14
SmiMI CAYNNNNRTG 1 cut(s) 176
Sse9I AATT 1 cut(s) 250
SspI AATATT 1 cut(s) 388
StyD4I CCNGG 1 cut(s) 258
TaaI ACNGT 2 cut(s) 130, 148
TasI AATT 1 cut(s) 250
TfiI GAWTC 1 cut(s) 288
Tru1I TTAA 6 cut(s) 92, 165, 212, 273, 330, 409
Tru9I TTAA 6 cut(s) 92, 165, 212, 273, 330, 409
TspDTI ATGAA 2 cut(s) 263, 398
XceI RCATGY 2 cut(s) 49, 309
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.