Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr2

Orthogroup ID

OG0024267

Physical Location & Seq

Genomic Coordinates Reverse (-)

10208490 .. 10209646

Gene Structure 1157 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom02g13630.3

Sequence Viewer

CDS Protein Promoter (2k)

Length: 207 bp

ATGGTTCTGGTTTCAAATGGGTCCATAAATTTGGTGGTTTTCTTTCGGGTTTTAGGATTTGTTTCTTCCTTTTTCCATTTGATATCATCACTAGCGGAGATGTTTGTGTTTATATACATGGGCTTTGATATTGCCATAGAACAACATAGCTGGTCACATGTGGGGTTCATTTTTCTCTCAATTGTATCCTTTGAATTAGTAGTCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005215 GO:0005451 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005768 GO:0005886 GO:0006810 GO:0006811 GO:0006812 GO:0006813 GO:0006814 GO:0006873 GO:0006885 GO:0008150 GO:0008324 GO:0009987 GO:0012505 GO:0015075 GO:0015077 GO:0015078 GO:0015079 GO:0015081 GO:0015291 GO:0015297 GO:0015298 GO:0015299 GO:0015318 GO:0015385 GO:0015386 GO:0015491 GO:0015672 GO:0016020 GO:0019725 GO:0022804 GO:0022821 GO:0022857 GO:0022890 GO:0030001 GO:0030003 GO:0030004 GO:0030641 GO:0031410 GO:0031982 GO:0034220 GO:0035725 GO:0042592 GO:0043226 GO:0043227 GO:0043229 GO:0044424 GO:0044444 GO:0044464 GO:0046873 GO:0048878 GO:0050801 GO:0051179 GO:0051234 GO:0051453 GO:0055067 GO:0055080 GO:0055082 GO:0055085 GO:0065007 GO:0065008 GO:0071804 GO:0071805 GO:0071944 GO:0097708 GO:0098655 GO:0098657 GO:0098659 GO:0098660 GO:0098662 GO:0098719 GO:0098739 GO:0098771 GO:0099516 GO:0099587 GO:1902600

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Na_H_Exchanger

Protein Analysis

69

Amino Acids

7.72

Weight (kDa)

5.25

Isoelectric Point (pI)

28.38

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024267)

Species	Orthologous Gene IDs
malus_domestica	MD14G1125300.v1.1
pyrus_communis	pycom02g13630 pycom14g00660

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	95
AcsI	RAATTY	1 cut(s)	28
AflIII	ACRYGT	1 cut(s)	157
AgsI	TTSAA	2 cut(s)	15, 194
AluBI	AGCT	1 cut(s)	150
AluI	AGCT	1 cut(s)	150
ApoI	RAATTY	1 cut(s)	28
AspS9I	GGNCC	1 cut(s)	21
AvaII	GGWCC	1 cut(s)	21
BciVI	GTATCC	1 cut(s)	196
BfaI	CTAG	1 cut(s)	92
BfuI	GTATCC	1 cut(s)	196
Bme18I	GGWCC	1 cut(s)	21
BmgT120I	GGNCC	1 cut(s)	21
BmiI	GGNNCC	1 cut(s)	22
BspACI	CCGC	1 cut(s)	95
BspLI	GGNNCC	1 cut(s)	22
BstNSI	RCATGY	1 cut(s)	161
BstXI	CCANNNNNNTGG	1 cut(s)	31
BsuI	GTATCC	1 cut(s)	196
Cfr13I	GGNCC	1 cut(s)	21
CviAII	CATG	2 cut(s)	118, 158
CviJI	RGCY	2 cut(s)	123, 150
CviKI_1	RGCY	2 cut(s)	123, 150
Eco32I	GATATC	1 cut(s)	84
Eco47I	GGWCC	1 cut(s)	21
EcoRV	GATATC	1 cut(s)	84
FaeI	CATG	2 cut(s)	121, 161
FaiI	YATR	7 cut(s)	26, 113, 115, 119, 137, 147, 159
FatI	CATG	2 cut(s)	117, 157
FspBI	CTAG	1 cut(s)	92
Hin1II	CATG	2 cut(s)	121, 161
Hsp92II	CATG	2 cut(s)	121, 161
LpnPI	CCDG	1 cut(s)	136
MaeI	CTAG	1 cut(s)	92
MaeIII	GTNAC	1 cut(s)	153
MboII	GAAGA	1 cut(s)	57
MfeI	CAATTG	1 cut(s)	180
MluCI	AATT	3 cut(s)	28, 180, 194
MunI	CAATTG	1 cut(s)	180
NlaIII	CATG	2 cut(s)	121, 161
NlaIV	GGNNCC	1 cut(s)	22
NmuCI	GTSAC	1 cut(s)	153
NspI	RCATGY	1 cut(s)	161
PciI	ACATGT	1 cut(s)	157
PscI	ACATGT	1 cut(s)	157
PspN4I	GGNNCC	1 cut(s)	22
PspPI	GGNCC	1 cut(s)	21
Sau96I	GGNCC	1 cut(s)	21
SetI	ASST	1 cut(s)	152
SgeI	CNNG	6 cut(s)	20, 59, 104, 130, 163, 170
SinI	GGWCC	1 cut(s)	21
Sse9I	AATT	3 cut(s)	28, 180, 194
SsiI	CCGC	1 cut(s)	95
SspMI	CTAG	1 cut(s)	92
TasI	AATT	3 cut(s)	28, 180, 194
TseFI	GTSAC	1 cut(s)	153
Tsp45I	GTSAC	1 cut(s)	153
TspDTI	ATGAA	1 cut(s)	157
VpaK11BI	GGWCC	1 cut(s)	21
XapI	RAATTY	1 cut(s)	28
XceI	RCATGY	1 cut(s)	161
XcmI	CCANNNNNNNNNTGG	1 cut(s)	31
XspI	CTAG	1 cut(s)	92

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.