Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr5

Orthogroup ID

OG0029275

Physical Location & Seq

Genomic Coordinates Reverse (-)

20072766 .. 20074085

Gene Structure 1320 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom05g16770.7

Sequence Viewer

CDS Protein Promoter (2k)

Length: 567 bp

ATGGAGAAAGTTGGCAAAGAGGGTGTTATTACCATAGCTGATGGAAAAACACTATATAATGAATTGGAGGTCGTTGAAGGAATGAAGCTGGATAGGGGCTACATATCCCCCTACTTCATCACCAATCCAAAGAACCAAAAATGTGAATTAGAAGATCCACTCGTCCTAATCCATGAGAAGAAACTCTCAAATTTGAATTCTATAGTGAAAATATTAGAGCTGGCCTTGCAGAAACAAAGACCTCTTGTAATTGTTGCTGAAGATGTGGAAAGTGAAGCACTTGCAACGCTCATTATAAACAAGCTTCGTGCTGGAATTAAGGTTTGTGCAATTAAAGCCCCTGGATTTGGAGAAAACAGGAAGGCAAATTTGCAGGACCTAGCCGTTCTTACGGGAGCCCAGGTAATAACTGAAGAGCTTGGTCTGAACATCGAAAAAGTGGGAATAGAAACACTTGGAACATGCAAAAGGATTACGGTATCAAAAGATGACACAGTCATTCTTGATGGGGCTGGTGACAAGAAAGCCATTGAAGAAAGATGTGAACAGCTGAGATCGATCAATTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

ko03018 ko04212 ko04940 ko05134 ko05152 map03018 map04212 map04940 map05134 map05152

Pfam Domains

Protein Families

Cpn60_TCP1

Protein Analysis

189

Amino Acids

20.65

Weight (kDa)

5.43

Isoelectric Point (pI)

34.33

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029275)

Species	Orthologous Gene IDs
pyrus_communis	pycom05g16770 pycom10g14710

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	296
AclWI	GGATC	1 cut(s)	149
AcsI	RAATTY	3 cut(s)	190, 196, 367
AcuI	CTGAAG	2 cut(s)	279, 432
AfiI	CCNNNNNNNGG	1 cut(s)	347
AgsI	TTSAA	3 cut(s)	77, 196, 533
AjnI	CCWGG	2 cut(s)	340, 399
AluBI	AGCT	6 cut(s)	38, 88, 220, 304, 418, 550
AluI	AGCT	6 cut(s)	38, 88, 220, 304, 418, 550
AlwI	GGATC	1 cut(s)	149
AoxI	GGCC	1 cut(s)	222
ApoI	RAATTY	3 cut(s)	190, 196, 367
AspS9I	GGNCC	1 cut(s)	376
AsuHPI	GGTGA	2 cut(s)	112, 527
AvaII	GGWCC	1 cut(s)	376
BanII	GRGCYC	1 cut(s)	400
BccI	CCATC	2 cut(s)	35, 500
BceAI	ACGGC	1 cut(s)	368
BciT130I	CCWGG	2 cut(s)	342, 401
BfaI	CTAG	1 cut(s)	380
BfmI	CTRYAG	1 cut(s)	201
Bme1390I	CCNGG	2 cut(s)	342, 401
Bme18I	GGWCC	1 cut(s)	376
BmgT120I	GGNCC	1 cut(s)	376
BmiI	GGNNCC	1 cut(s)	397
BmrFI	CCNGG	2 cut(s)	342, 401
Bsa29I	ATCGAT	1 cut(s)	557
BsaJI	CCNNGG	2 cut(s)	340, 399
BsaXI	ACNNNNNCTCC	2 cut(s)	387, 417
Bsc4I	CCNNNNNNNGG	1 cut(s)	347
BseBI	CCWGG	2 cut(s)	342, 401
BseCI	ATCGAT	1 cut(s)	557
BseDI	CCNNGG	2 cut(s)	340, 399
BseLI	CCNNNNNNNGG	1 cut(s)	347
BseMII	CTCAG	1 cut(s)	542
BshFI	GGCC	1 cut(s)	224
BshVI	ATCGAT	1 cut(s)	557
BslI	CCNNNNNNNGG	1 cut(s)	347
BsnI	GGCC	1 cut(s)	224
Bsp1286I	GDGCHC	1 cut(s)	400
Bsp143I	GATC	3 cut(s)	154, 554, 558
BspANI	GGCC	1 cut(s)	224
BspCNI	CTCAG	1 cut(s)	543
BspDI	ATCGAT	1 cut(s)	557
BspLI	GGNNCC	1 cut(s)	397
BspPI	GGATC	1 cut(s)	149
BspQI	GCTCTTC	1 cut(s)	408
BssECI	CCNNGG	2 cut(s)	340, 399
BssMI	GATC	3 cut(s)	154, 554, 558
Bst2UI	CCWGG	2 cut(s)	342, 401
Bst4CI	ACNGT	2 cut(s)	478, 496
Bst6I	CTCTTC	1 cut(s)	408
BstC8I	GCNNGC	1 cut(s)	222
BstDEI	CTNAG	1 cut(s)	551
BstKTI	GATC	3 cut(s)	157, 557, 561
BstMBI	GATC	3 cut(s)	154, 554, 558
BstMWI	GCNNNNNNNGC	2 cut(s)	226, 335
BstNI	CCWGG	2 cut(s)	342, 401
BstNSI	RCATGY	1 cut(s)	465
BstSCI	CCNGG	2 cut(s)	340, 399
BstSFI	CTRYAG	1 cut(s)	201
BstX2I	RGATCY	1 cut(s)	154
BstYI	RGATCY	1 cut(s)	154
Bsu15I	ATCGAT	1 cut(s)	557
BsuRI	GGCC	1 cut(s)	224
BsuTUI	ATCGAT	1 cut(s)	557
Cac8I	GCNNGC	1 cut(s)	222
Cfr13I	GGNCC	1 cut(s)	376
ClaI	ATCGAT	1 cut(s)	557
CviAII	CATG	2 cut(s)	173, 462
DdeI	CTNAG	1 cut(s)	551
DpnI	GATC	3 cut(s)	156, 556, 560
DpnII	GATC	3 cut(s)	154, 554, 558
Eam1104I	CTCTTC	1 cut(s)	408
EarI	CTCTTC	1 cut(s)	408
Eco24I	GRGCYC	1 cut(s)	400
Eco47I	GGWCC	1 cut(s)	376
Eco57I	CTGAAG	2 cut(s)	279, 432
EcoO109I	RGGNCCY	1 cut(s)	376
EcoRI	GAATTC	1 cut(s)	196
EcoRII	CCWGG	2 cut(s)	340, 399
EcoT38I	GRGCYC	1 cut(s)	400
FaeI	CATG	2 cut(s)	176, 465
FaiI	YATR	8 cut(s)	35, 55, 57, 104, 174, 203, 296, 463
FatI	CATG	2 cut(s)	172, 461
FriOI	GRGCYC	1 cut(s)	400
FspBI	CTAG	1 cut(s)	380
HaeIII	GGCC	1 cut(s)	224
Hin1II	CATG	2 cut(s)	176, 465
HindIII	AAGCTT	1 cut(s)	302
HphI	GGTGA	2 cut(s)	112, 527
Hpy166II	GTNNAC	1 cut(s)	545
Hpy188I	TCNGA	1 cut(s)	426
Hpy188III	TCNNGA	1 cut(s)	503
Hpy8I	GTNNAC	1 cut(s)	545
HpyAV	CCTTC	2 cut(s)	71, 355
HpyCH4III	ACNGT	2 cut(s)	478, 496
HpyCH4V	TGCA	5 cut(s)	229, 284, 329, 373, 465
HpyF10VI	GCNNNNNNNGC	2 cut(s)	226, 335
HpyF3I	CTNAG	1 cut(s)	551
Hsp92II	CATG	2 cut(s)	176, 465
Kzo9I	GATC	3 cut(s)	154, 554, 558
LguI	GCTCTTC	1 cut(s)	408
LmnI	GCTCC	1 cut(s)	395
MaeI	CTAG	1 cut(s)	380
MaeIII	GTNAC	1 cut(s)	515
MalI	GATC	3 cut(s)	156, 556, 560
MboI	GATC	3 cut(s)	154, 554, 558
MboII	GAAGA	5 cut(s)	164, 190, 272, 425, 545
MfeI	CAATTG	1 cut(s)	562
MflI	RGATCY	1 cut(s)	154
MhlI	GDGCHC	1 cut(s)	400
MluCI	AATT	9 cut(s)	62, 146, 190, 196, 249, 315, 330, 367, 562
MnlI	CCTC	3 cut(s)	13, 61, 252
MseI	TTAA	2 cut(s)	318, 333
MspA1I	CMGCKG	1 cut(s)	550
MspR9I	CCNGG	2 cut(s)	342, 401
MunI	CAATTG	1 cut(s)	562
MvaI	CCWGG	2 cut(s)	342, 401
MwoI	GCNNNNNNNGC	2 cut(s)	226, 335
NdeII	GATC	3 cut(s)	154, 554, 558
NlaIII	CATG	2 cut(s)	176, 465
NlaIV	GGNNCC	1 cut(s)	397
NmuCI	GTSAC	1 cut(s)	515
NspI	RCATGY	1 cut(s)	465
PciSI	GCTCTTC	1 cut(s)	408
PflFI	GACNNNGTC	1 cut(s)	494
PpuMI	RGGWCCY	1 cut(s)	376
PsiI	TTATAA	1 cut(s)	296
Psp5II	RGGWCCY	1 cut(s)	376
Psp6I	CCWGG	2 cut(s)	340, 399
PspGI	CCWGG	2 cut(s)	340, 399
PspN4I	GGNNCC	1 cut(s)	397
PspPI	GGNCC	1 cut(s)	376
PspPPI	RGGWCCY	1 cut(s)	376
PsuI	RGATCY	1 cut(s)	154
PsyI	GACNNNGTC	1 cut(s)	494
PvuII	CAGCTG	1 cut(s)	550
SapI	GCTCTTC	1 cut(s)	408
SaqAI	TTAA	2 cut(s)	318, 333
Sau3AI	GATC	3 cut(s)	154, 554, 558
Sau96I	GGNCC	1 cut(s)	376
ScrFI	CCNGG	2 cut(s)	342, 401
SduI	GDGCHC	1 cut(s)	400
SfcI	CTRYAG	1 cut(s)	201
SinI	GGWCC	1 cut(s)	376
Sse9I	AATT	9 cut(s)	62, 146, 190, 196, 249, 315, 330, 367, 562
SspI	AATATT	1 cut(s)	213
SspMI	CTAG	1 cut(s)	380
StyD4I	CCNGG	2 cut(s)	340, 399
TaaI	ACNGT	2 cut(s)	478, 496
TaqI	TCGA	2 cut(s)	432, 557
TasI	AATT	9 cut(s)	62, 146, 190, 196, 249, 315, 330, 367, 562
Tru1I	TTAA	2 cut(s)	318, 333
Tru9I	TTAA	2 cut(s)	318, 333
TseFI	GTSAC	1 cut(s)	515
Tsp45I	GTSAC	1 cut(s)	515
TspDTI	ATGAA	3 cut(s)	75, 98, 106
Tth111I	GACNNNGTC	1 cut(s)	494
VpaK11BI	GGWCC	1 cut(s)	376
XapI	RAATTY	3 cut(s)	190, 196, 367
XceI	RCATGY	1 cut(s)	465
XspI	CTAG	1 cut(s)	380

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.