pycom07g00980

Belongs to the UDP-glucose GDP-mannose dehydrogenase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
OG0023902
Physical Location & Seq
Forward (+)
826958 .. 827161
204 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g00980.1

Sequence Viewer

Length: 204 bp
ATGATTAAGATGATGGGGACAATAAGAAATAATAAGATTCTTATATTCGAAGTTTTCTACAAAAAGAATACAAACGATGTGCGAAATTCAATGGCAATAAAGATTTGCAAATGTCTGTTGAAAGAAAGATGGGATAAATTAGCGATTTATGATGCTAAAGCAAGAAGAGAAGACATAGTACGATCCCTGCTCTTCTTGCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00040 ko00053 ko00520 ko01100 map00040 map00053 map00520 map01100
Pfam Domains
Protein Families
UDPG_MGDP_dh UDPG_MGDP_dh_C UDPG_MGDP_dh_N

Protein Analysis

68

Amino Acids

8.04

Weight (kDa)

9.95

Isoelectric Point (pI)

49.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
UDPG_MGDP_dh_C PF03720 18 - 59 7.8e-07 UDP-glucose/GDP-mannose dehydrogenase family, UDP binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0023902)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G01010
pyrus_communis pycom07g00980 pycom16g05510

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 177
AcsI RAATTY 1 cut(s) 85
AfaI GTAC 1 cut(s) 180
AgsI TTSAA 2 cut(s) 90, 121
AlwI GGATC 1 cut(s) 177
ApoI RAATTY 1 cut(s) 85
AsuII TTCGAA 1 cut(s) 48
BarI GAAGNNNNNNTAC 2 cut(s) 162, 194
BbsI GAAGAC 1 cut(s) 177
BccI CCATC 2 cut(s) 7, 123
BmsI GCATC 1 cut(s) 142
BpiI GAAGAC 1 cut(s) 177
Bpu14I TTCGAA 1 cut(s) 48
BslFI GGGAC 1 cut(s) 31
BsmFI GGGAC 1 cut(s) 31
Bsp119I TTCGAA 1 cut(s) 48
Bsp143I GATC 1 cut(s) 182
BspPI GGATC 1 cut(s) 177
BspQI GCTCTTC 1 cut(s) 197
BspT104I TTCGAA 1 cut(s) 48
BssMI GATC 1 cut(s) 182
Bst6I CTCTTC 2 cut(s) 160, 197
BstBI TTCGAA 1 cut(s) 48
BstKTI GATC 1 cut(s) 185
BstMBI GATC 1 cut(s) 182
BstMWI GCNNNNNNNGC 1 cut(s) 196
BstV2I GAAGAC 1 cut(s) 177
Csp6I GTAC 1 cut(s) 179
CviQI GTAC 1 cut(s) 179
DpnI GATC 1 cut(s) 184
DpnII GATC 1 cut(s) 182
Eam1104I CTCTTC 2 cut(s) 160, 197
EarI CTCTTC 2 cut(s) 160, 197
FaiI YATR 3 cut(s) 44, 150, 176
FaqI GGGAC 1 cut(s) 31
FspEI CC 5 cut(s) 77, 115, 116, 199, 200
HinfI GANTC 1 cut(s) 37
HpyCH4V TGCA 1 cut(s) 108
HpyF10VI GCNNNNNNNGC 1 cut(s) 196
Kzo9I GATC 1 cut(s) 182
LguI GCTCTTC 1 cut(s) 197
LpnPI CCDG 1 cut(s) 200
LweI GCATC 1 cut(s) 142
MalI GATC 1 cut(s) 184
MboI GATC 1 cut(s) 182
MboII GAAGA 3 cut(s) 177, 182, 184
MluCI AATT 2 cut(s) 85, 137
MseI TTAA 1 cut(s) 6
MwoI GCNNNNNNNGC 1 cut(s) 196
NdeII GATC 1 cut(s) 182
NspV TTCGAA 1 cut(s) 48
PciSI GCTCTTC 1 cut(s) 197
PfeI GAWTC 1 cut(s) 37
RsaI GTAC 1 cut(s) 180
RsaNI GTAC 1 cut(s) 179
SapI GCTCTTC 1 cut(s) 197
SaqAI TTAA 1 cut(s) 6
Sau3AI GATC 1 cut(s) 182
SfaNI GCATC 1 cut(s) 142
SfuI TTCGAA 1 cut(s) 48
SgeI CNNG 2 cut(s) 174, 199
Sse9I AATT 2 cut(s) 85, 137
TaqI TCGA 1 cut(s) 48
TasI AATT 2 cut(s) 85, 137
TfiI GAWTC 1 cut(s) 37
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
XapI RAATTY 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.