pycom08g13430

This protein plays a role in synthesis of starch. It catalyzes the synthesis of the activated glycosyl donor, ADP- glucose from Glc-1-P and ATP

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
OG0028848
Physical Location & Seq
Reverse (-)
12234866 .. 12235813
948 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom08g13430.1

Sequence Viewer

Length: 438 bp
ATGGGTGTTTTTGTGTTCAGAACTGATGTCCTACTTAAGCTATTAAGGTGGAGCTATCCTTCTTGCAATGATTTTGGCTCCGAGATTATTCCATCAGCTGTGAAGGAGCACAACGTCGAGGCATATCTATTCAATCACTACTGGGAGGATATTGGAACAGTAAAGTCTATCTTAGATGCAAACTTGGCCCTCACAGAACAGGAAGGTGATTGCATAATCCACCGAGCTAGGAAAAAGGGTAAAATCAGTTATGGGTGGCTATATGTAGGAATGCATGGATACATTAATAGGAAAATCTCATTATTTTGTTGGTCTTTTATCTTGAACACTTGTAAACATGTTCTTTATGAGGAATATTTATGTAGTTTCATTATAGACATTTCATTTCTACTATTGGATTGCTTTTTACAGCCGAGATTGCCATCTTTGATTTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00500 ko00520 ko01100 ko01110 ko02026 map00500 map00520 map01100 map01110 map02026
Pfam Domains
Protein Families
NTP_transferase

Protein Analysis

146

Amino Acids

16.94

Weight (kDa)

6.5

Isoelectric Point (pI)

42.33

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NTP_transferase PF00483 1 - 66 2.7e-11 Nucleotidyl transferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0028848)

Species Orthologous Gene IDs
malus_domestica MD07G1140700.v1.1
pyrus_communis pycom08g13430

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflII CTTAAG 1 cut(s) 35
AflIII ACRYGT 1 cut(s) 337
AgsI TTSAA 2 cut(s) 133, 325
AluBI AGCT 4 cut(s) 40, 54, 98, 227
AluI AGCT 4 cut(s) 40, 54, 98, 227
Alw21I GWGCWC 1 cut(s) 111
AoxI GGCC 1 cut(s) 186
AseI ATTAAT 1 cut(s) 285
AspS9I GGNCC 1 cut(s) 187
AsuHPI GGTGA 1 cut(s) 218
Bbv12I GWGCWC 1 cut(s) 111
BccI CCATC 2 cut(s) 100, 430
BciVI GTATCC 1 cut(s) 272
BfaI CTAG 1 cut(s) 228
BfrI CTTAAG 1 cut(s) 35
BfuI GTATCC 1 cut(s) 272
BmgT120I GGNCC 1 cut(s) 187
BmiI GGNNCC 1 cut(s) 79
BmrI ACTGGG 1 cut(s) 151
BmsI GCATC 1 cut(s) 166
BmuI ACTGGG 1 cut(s) 151
BsaBI GATNNNNATC 1 cut(s) 421
Bse1I ACTGG 1 cut(s) 146
Bse3DI GCAATG 1 cut(s) 73
Bse8I GATNNNNATC 1 cut(s) 421
BseJI GATNNNNATC 1 cut(s) 421
BseMI GCAATG 1 cut(s) 73
BseNI ACTGG 1 cut(s) 146
BshFI GGCC 1 cut(s) 188
BsiHKAI GWGCWC 1 cut(s) 111
BsmI GAATGC 1 cut(s) 276
BsnI GGCC 1 cut(s) 188
Bsp1286I GDGCHC 1 cut(s) 111
BspANI GGCC 1 cut(s) 188
BspLI GGNNCC 1 cut(s) 79
BspTI CTTAAG 1 cut(s) 35
BsrDI GCAATG 1 cut(s) 73
BsrI ACTGG 1 cut(s) 146
Bst4CI ACNGT 1 cut(s) 160
BstAFI CTTAAG 1 cut(s) 35
BstDEI CTNAG 1 cut(s) 172
BstMWI GCNNNNNNNGC 2 cut(s) 185, 418
BstNSI RCATGY 1 cut(s) 341
BsuI GTATCC 1 cut(s) 272
BsuRI GGCC 1 cut(s) 188
Cfr13I GGNCC 1 cut(s) 187
CviAII CATG 2 cut(s) 275, 338
CviJI RGCY 8 cut(s) 40, 54, 78, 98, 188, 227, 259, 412
CviKI_1 RGCY 8 cut(s) 40, 54, 78, 98, 188, 227, 259, 412
DdeI CTNAG 1 cut(s) 172
EcoT22I ATGCAT 1 cut(s) 276
FaeI CATG 2 cut(s) 278, 341
FalI AAGNNNNNCTT 2 cut(s) 155, 187
FatI CATG 2 cut(s) 274, 337
FspBI CTAG 1 cut(s) 228
HaeIII GGCC 1 cut(s) 188
Hin1II CATG 2 cut(s) 278, 341
HphI GGTGA 1 cut(s) 218
Hpy166II GTNNAC 1 cut(s) 335
Hpy188I TCNGA 3 cut(s) 20, 82, 437
Hpy188III TCNNGA 1 cut(s) 322
Hpy8I GTNNAC 1 cut(s) 335
Hpy99I CGWCG 1 cut(s) 119
HpyAV CCTTC 3 cut(s) 69, 97, 197
HpyCH4III ACNGT 1 cut(s) 160
HpyCH4IV ACGT 1 cut(s) 114
HpyCH4V TGCA 4 cut(s) 66, 179, 213, 274
HpyF10VI GCNNNNNNNGC 2 cut(s) 185, 418
HpyF3I CTNAG 1 cut(s) 172
HpySE526I ACGT 1 cut(s) 114
Hsp92II CATG 2 cut(s) 278, 341
LmnI GCTCC 3 cut(s) 51, 83, 106
LpnPI CCDG 2 cut(s) 127, 185
LweI GCATC 1 cut(s) 166
MaeI CTAG 1 cut(s) 228
MaeII ACGT 1 cut(s) 114
MhlI GDGCHC 1 cut(s) 111
MnlI CCTC 4 cut(s) 112, 139, 200, 343
Mph1103I ATGCAT 1 cut(s) 276
MseI TTAA 3 cut(s) 36, 44, 285
MspA1I CMGCKG 1 cut(s) 98
MspCI CTTAAG 1 cut(s) 35
Mva1269I GAATGC 1 cut(s) 276
MwoI GCNNNNNNNGC 2 cut(s) 185, 418
NlaIII CATG 2 cut(s) 278, 341
NlaIV GGNNCC 1 cut(s) 79
NmeAIII GCCGAG 1 cut(s) 438
NsiI ATGCAT 1 cut(s) 276
NspI RCATGY 1 cut(s) 341
PciI ACATGT 1 cut(s) 337
PctI GAATGC 1 cut(s) 276
PscI ACATGT 1 cut(s) 337
PshBI ATTAAT 1 cut(s) 285
PspN4I GGNNCC 1 cut(s) 79
PspPI GGNCC 1 cut(s) 187
PvuII CAGCTG 1 cut(s) 98
SaqAI TTAA 3 cut(s) 36, 44, 285
Sau96I GGNCC 1 cut(s) 187
SduI GDGCHC 1 cut(s) 111
SetI ASST 7 cut(s) 42, 50, 56, 100, 117, 208, 229
SfaNI GCATC 1 cut(s) 166
SmlI CTYRAG 1 cut(s) 35
SmoI CTYRAG 1 cut(s) 35
SspI AATATT 1 cut(s) 356
SspMI CTAG 1 cut(s) 228
TaaI ACNGT 1 cut(s) 160
TaiI ACGT 1 cut(s) 117
TaqI TCGA 1 cut(s) 117
Tru1I TTAA 3 cut(s) 36, 44, 285
Tru9I TTAA 3 cut(s) 36, 44, 285
TspDTI ATGAA 2 cut(s) 358, 372
Vha464I CTTAAG 1 cut(s) 35
VspI ATTAAT 1 cut(s) 285
XceI RCATGY 1 cut(s) 341
XspI CTAG 1 cut(s) 228
Zsp2I ATGCAT 1 cut(s) 276
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.